Incidental Mutation 'R1837:Olfr1436'
ID205447
Institutional Source Beutler Lab
Gene Symbol Olfr1436
Ensembl Gene ENSMUSG00000067513
Gene Nameolfactory receptor 1436
SynonymsGA_x6K02T2RE5P-2634596-2633658, MOR214-2
MMRRC Submission 039864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1837 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12298183-12299130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12298376 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 252 (V252A)
Ref Sequence ENSEMBL: ENSMUSP00000085113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087812]
Predicted Effect probably damaging
Transcript: ENSMUST00000087812
AA Change: V252A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085113
Gene: ENSMUSG00000067513
AA Change: V252A

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.4e-54 PFAM
Pfam:7tm_1 45 294 1.3e-19 PFAM
Meta Mutation Damage Score 0.3491 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 G T 2: 154,553,042 G305W probably damaging Het
Actr3b A T 5: 25,825,159 T74S probably benign Het
Add2 A G 6: 86,118,558 E652G probably damaging Het
Alg9 T A 9: 50,806,315 V83D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Bcr A G 10: 75,168,100 probably benign Het
Begain G A 12: 109,035,323 probably benign Het
Bzw1 A G 1: 58,400,118 K67E probably damaging Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Cdc73 T A 1: 143,667,657 T314S possibly damaging Het
Cfap206 T C 4: 34,728,813 T31A probably damaging Het
Cfap58 G A 19: 48,029,139 E813K probably damaging Het
Clstn2 C A 9: 97,583,540 A133S probably benign Het
Col14a1 A T 15: 55,382,495 D465V unknown Het
Col2a1 C T 15: 97,996,641 probably benign Het
Dab2 A G 15: 6,336,476 probably benign Het
Eme1 T C 11: 94,645,961 D464G probably benign Het
Eml6 T C 11: 29,749,802 probably null Het
Ern1 C A 11: 106,458,957 L44F probably damaging Het
Fam111a T A 19: 12,587,452 S188R probably benign Het
Fam151b A T 13: 92,474,131 probably benign Het
Fmo6 T C 1: 162,922,810 N226D probably benign Het
Ggt1 A G 10: 75,579,294 D214G probably benign Het
Gm14226 A G 2: 155,025,010 I296V probably benign Het
Gm9915 A T 1: 42,230,687 noncoding transcript Het
Heatr5b T C 17: 78,820,751 D485G possibly damaging Het
Helz2 A T 2: 181,229,289 I2785N probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Hydin C A 8: 110,569,625 H3595Q probably benign Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krt7 A G 15: 101,419,582 D252G probably benign Het
Lad1 C A 1: 135,829,706 D394E probably benign Het
Lhx8 A T 3: 154,328,055 C38S possibly damaging Het
Lta4h C T 10: 93,469,175 T280M probably damaging Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Med1 G T 11: 98,169,412 D230E probably damaging Het
Mmp1b A T 9: 7,386,409 F171I probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mtrf1 A G 14: 79,401,833 E135G possibly damaging Het
Muc5ac T A 7: 141,807,086 M1378K probably benign Het
Myo3a A T 2: 22,577,592 Q286L possibly damaging Het
Ndor1 C T 2: 25,248,396 G391R probably damaging Het
Nefl C T 14: 68,086,626 R438C probably damaging Het
Nlrp3 G A 11: 59,548,916 V440I probably benign Het
Notch3 A T 17: 32,124,322 L1959Q probably damaging Het
Noto A G 6: 85,424,177 T63A probably benign Het
Oc90 G A 15: 65,889,680 T163M probably damaging Het
Olfr1219 A T 2: 89,074,832 Y86* probably null Het
Olfr365 T A 2: 37,202,102 M287K probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Phlda1 A G 10: 111,507,231 Q276R probably benign Het
Ptpn21 T G 12: 98,733,626 K10Q probably damaging Het
Ptprb A G 10: 116,341,626 E1364G probably benign Het
Rabep1 T A 11: 70,904,658 W237R probably damaging Het
Rai1 A T 11: 60,189,398 K1429N probably damaging Het
Rapgef1 A G 2: 29,737,426 I1027M probably damaging Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Rpap1 A C 2: 119,769,885 probably null Het
Senp7 T A 16: 56,158,516 C471S probably benign Het
Slc16a14 A G 1: 84,912,399 V395A probably benign Het
Slc45a1 C T 4: 150,638,459 G323S probably benign Het
Syne2 A T 12: 75,967,660 E3208D probably damaging Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Ticam1 T C 17: 56,270,799 E432G possibly damaging Het
Tmem192 C A 8: 64,964,340 probably benign Het
Trub1 T C 19: 57,453,029 V28A probably benign Het
Ttc21b A T 2: 66,197,762 L1121H probably benign Het
Ttc38 A G 15: 85,851,563 D290G probably damaging Het
Ulk1 C T 5: 110,789,381 G683D probably damaging Het
Vmn1r122 A T 7: 21,133,366 F255I probably benign Het
Vmn2r68 T A 7: 85,233,678 I289F probably damaging Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Wdr48 T G 9: 119,905,416 S134A probably damaging Het
Yap1 A T 9: 7,962,349 Y139N probably damaging Het
Ylpm1 T C 12: 85,029,333 V486A possibly damaging Het
Zbtb38 T C 9: 96,686,995 T679A probably benign Het
Zfp292 A G 4: 34,810,264 S927P probably damaging Het
Zfp324 C T 7: 12,970,229 T115I probably benign Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp945 A T 17: 22,851,273 C551S probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Olfr1436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Olfr1436 APN 19 12298785 missense probably damaging 0.99
IGL02129:Olfr1436 APN 19 12298458 missense probably damaging 1.00
PIT4378001:Olfr1436 UTSW 19 12298712 missense probably damaging 1.00
R0727:Olfr1436 UTSW 19 12299094 missense probably benign 0.03
R1244:Olfr1436 UTSW 19 12298496 missense probably damaging 0.98
R1647:Olfr1436 UTSW 19 12298659 missense probably benign
R1648:Olfr1436 UTSW 19 12298659 missense probably benign
R1899:Olfr1436 UTSW 19 12298343 missense probably damaging 1.00
R2031:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R2305:Olfr1436 UTSW 19 12299087 missense probably benign 0.01
R4624:Olfr1436 UTSW 19 12298983 missense probably benign
R4681:Olfr1436 UTSW 19 12299049 missense probably benign 0.05
R4790:Olfr1436 UTSW 19 12298941 missense possibly damaging 0.60
R4865:Olfr1436 UTSW 19 12298580 missense probably damaging 1.00
R4941:Olfr1436 UTSW 19 12298896 missense possibly damaging 0.95
R5138:Olfr1436 UTSW 19 12298776 missense possibly damaging 0.56
R5161:Olfr1436 UTSW 19 12298789 missense probably damaging 0.99
R5560:Olfr1436 UTSW 19 12298644 nonsense probably null
R5983:Olfr1436 UTSW 19 12299103 missense probably benign 0.00
R6736:Olfr1436 UTSW 19 12298572 nonsense probably null
R6882:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R6883:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R7465:Olfr1436 UTSW 19 12298437 missense probably benign 0.04
R7500:Olfr1436 UTSW 19 12298677 missense probably damaging 0.98
R7529:Olfr1436 UTSW 19 12298722 missense probably damaging 1.00
R7565:Olfr1436 UTSW 19 12298848 missense probably benign 0.09
R7611:Olfr1436 UTSW 19 12298878 missense probably damaging 0.99
R7850:Olfr1436 UTSW 19 12298632 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAGCAGCATCCCAGCTTC -3'
(R):5'- TCTGTGACATTCCCCAGTTG -3'

Sequencing Primer
(F):5'- AGCAGCATCCCAGCTTCTTCTG -3'
(R):5'- GTGACATTCCCCAGTTGTTAAATC -3'
Posted On2014-06-23