Mutagenetix > Incidental Mutation

Incidental Mutation 'R1838:Adgrb3'

205452

Institutional Source

Beutler Lab

Gene Symbol

Adgrb3

Ensembl Gene

ENSMUSG00000033569

Gene Name

adhesion G protein-coupled receptor B3

Synonyms

Bai3, A830096D10Rik

MMRRC Submission

039865-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.433) question?

Stock #

R1838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25067476-25829707 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25084270 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1417 (S1417P)

Ref Sequence

ENSEMBL: ENSMUSP00000116231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]

AlphaFold

Q80ZF8

Predicted Effect

probably damaging
Transcript: ENSMUST00000041838
AA Change: S1417P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: S1417P

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000126626
AA Change: S547P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569
AA Change: S547P

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	273	7.3e-65	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000135518
AA Change: S1417P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: S1417P

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000146592
AA Change: S1177P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: S1177P

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
TSP1	87	136	2.1e-12	SMART
TSP1	141	191	7.97e-13	SMART
TSP1	196	246	6.28e-11	SMART
TSP1	251	301	1.48e-7	SMART
HormR	303	369	4.15e-20	SMART
Pfam:DUF3497	379	603	2.5e-52	PFAM
GPS	608	661	1.24e-21	SMART
Pfam:7tm_2	667	903	5.4e-66	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000151309
AA Change: S1417P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: S1417P

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:GAIN	589	794	1.1e-44	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	875	1143	2.7e-63	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153568

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	T	C	6: 132,626,727	D22G	unknown	Het
Abca4	G	A	3: 122,128,305	R1170K	probably benign	Het
Adam28	T	C	14: 68,639,210	N197S	possibly damaging	Het
Adamtsl3	G	T	7: 82,493,373	R267L	probably damaging	Het
Adgrb2	A	T	4: 130,010,231	T717S	probably benign	Het
Afg3l2	A	T	18: 67,414,172	V561D	probably damaging	Het
Atp13a2	T	A	4: 140,994,332	Y244*	probably null	Het
BB014433	C	G	8: 15,042,629	V75L	unknown	Het
Btnl6	T	A	17: 34,515,542	D82V	probably damaging	Het
Ccdc178	A	G	18: 22,067,638	Y421H	probably damaging	Het
Cdc123	A	T	2: 5,794,891		probably null	Het
Cdhr5	C	T	7: 141,272,603	V367I	possibly damaging	Het
Celsr3	A	G	9: 108,829,906	H1196R	probably benign	Het
Chd8	T	C	14: 52,204,883	S2077G	probably benign	Het
Col6a5	G	A	9: 105,864,833	H2296Y	probably benign	Het
Ctnna2	T	C	6: 77,845,542	D26G	probably damaging	Het
Ctr9	G	T	7: 111,052,303	R910L	possibly damaging	Het
Cyp2t4	G	T	7: 27,158,416	R455L	possibly damaging	Het
Cyp3a13	A	T	5: 137,911,632		probably null	Het
Dennd3	T	C	15: 73,565,100	S1059P	probably damaging	Het
Dennd4c	A	G	4: 86,825,178	T1135A	probably benign	Het
Dnah7b	T	C	1: 46,116,177	V295A	probably benign	Het
Dnah7b	C	A	1: 46,277,105	T3126K	probably damaging	Het
Ehbp1l1	C	T	19: 5,717,691	E1195K	probably benign	Het
Exoc6b	T	A	6: 84,853,678	I447L	probably benign	Het
Glt1d1	G	A	5: 127,678,129	V202I	probably benign	Het
Grk1	T	C	8: 13,416,155	V533A	possibly damaging	Het
Gsdma3	C	T	11: 98,629,858	A105V	probably benign	Het
Gzma	T	A	13: 113,095,984	I131F	probably damaging	Het
Helq	A	T	5: 100,771,879	L35*	probably null	Het
Hnrnpll	T	C	17: 80,038,623	N403S	probably damaging	Het
Hsf5	A	G	11: 87,636,055	K518E	probably benign	Het
Ighe	T	A	12: 113,271,850	H258L	unknown	Het
Il6ra	T	C	3: 89,890,272	D96G	probably benign	Het
Ints13	C	T	6: 146,566,611	A129T	possibly damaging	Het
Ipo7	T	A	7: 110,042,109	H345Q	probably damaging	Het
Kcna2	A	T	3: 107,104,512	E136D	probably benign	Het
Kif5a	G	A	10: 127,236,815	Q702*	probably null	Het
Klhdc7a	G	T	4: 139,967,070	P189T	probably benign	Het
Krtap4-9	A	G	11: 99,785,396		probably benign	Het
Lamc3	T	C	2: 31,925,582	S1097P	possibly damaging	Het
Ldlrad2	A	T	4: 137,572,170	N114K	probably benign	Het
Lrfn1	A	T	7: 28,459,768	I371L	probably damaging	Het
Lrwd1	A	G	5: 136,132,388	V240A	probably benign	Het
Lypd1	A	T	1: 125,873,371		probably benign	Het
Magi2	A	T	5: 20,465,827	T163S	probably damaging	Het
Man2c1	A	G	9: 57,137,337	N354S	probably benign	Het
Map3k13	T	C	16: 21,914,189	Y514H	possibly damaging	Het
Med15	T	C	16: 17,653,562	D577G	probably benign	Het
Mroh4	A	T	15: 74,616,113	M320K	probably benign	Het
Ms4a10	T	A	19: 10,964,047	D186V	possibly damaging	Het
Myh7	T	C	14: 54,973,180	N1725S	possibly damaging	Het
Myo5c	A	T	9: 75,273,553	R741S	probably damaging	Het
Naip6	T	C	13: 100,316,136	D139G	probably damaging	Het
Nat6	G	A	9: 107,583,017	R37H	possibly damaging	Het
Olfr1252	A	T	2: 89,721,709	M134K	probably damaging	Het
Olfr1370	A	T	13: 21,072,425	L292*	probably null	Het
Olfr229	A	T	9: 39,909,841	I13F	possibly damaging	Het
Olfr982	A	T	9: 40,074,309	M5L	probably benign	Het
Pcdhb3	A	G	18: 37,301,317	D112G	probably benign	Het
Pdpr	C	A	8: 111,134,734	P787T	probably damaging	Het
Pgm3	C	T	9: 86,569,233	V123I	probably benign	Het
Pms1	A	C	1: 53,192,098		probably null	Het
Prl2b1	A	G	13: 27,388,566	S14P	possibly damaging	Het
Prune2	T	A	19: 17,199,878	W212R	probably damaging	Het
Rabgef1	A	G	5: 130,213,021	E422G	probably benign	Het
Ralyl	A	G	3: 14,143,412	E204G	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rbpms2	TGCCGCCGCC	TGCCGCCGCCGCC	9: 65,651,680		probably benign	Het
Rit1	C	G	3: 88,729,170	T127S	probably damaging	Het
Slc16a7	C	T	10: 125,231,198	V191M	probably damaging	Het
Slc34a2	A	T	5: 53,058,436	H63L	probably benign	Het
Smpd4	G	A	16: 17,642,302		probably null	Het
Sp3	A	G	2: 72,938,176	S748P	possibly damaging	Het
Spata31d1b	G	A	13: 59,715,857	C273Y	probably benign	Het
Spata31d1b	G	A	13: 59,717,465	R809K	probably benign	Het
Tmco5	A	T	2: 116,880,879	E90V	probably damaging	Het
Tnxb	A	T	17: 34,678,910	D844V	probably damaging	Het
Tpi1	T	C	6: 124,814,152	T41A	probably benign	Het
Ttn	T	C	2: 76,727,192	I29853V	probably damaging	Het
Vmn2r26	C	T	6: 124,024,771	T5I	probably benign	Het
Wdr95	A	G	5: 149,599,366	D663G	probably benign	Het
Zbtb39	T	C	10: 127,742,700	F381S	probably damaging	Het
Zfp523	T	A	17: 28,194,993	I34N	probably damaging	Het
Zfp646	T	A	7: 127,879,739	Y363N	probably damaging	Het
Zfp712	A	C	13: 67,042,047	C139G	probably damaging	Het
Zfp958	A	G	8: 4,628,590	H205R	probably damaging	Het
Zfp974	G	A	7: 27,910,356	P648L	possibly damaging	Het

Other mutations in Adgrb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Adgrb3	APN	1	25228500	missense	probably benign	0.09
IGL00507:Adgrb3	APN	1	25074715	missense	possibly damaging	0.93
IGL00828:Adgrb3	APN	1	25488119	missense	possibly damaging	0.73
IGL01285:Adgrb3	APN	1	25093787	missense	probably benign	0.32
IGL01309:Adgrb3	APN	1	25112271	missense	possibly damaging	0.69
IGL01540:Adgrb3	APN	1	25112171	splice site	probably null
IGL01608:Adgrb3	APN	1	25553774	missense	probably damaging	1.00
IGL01638:Adgrb3	APN	1	25559751	splice site	probably benign
IGL01657:Adgrb3	APN	1	25826493	missense	probably benign	0.03
IGL01666:Adgrb3	APN	1	25460751	missense	probably damaging	0.96
IGL01712:Adgrb3	APN	1	25826279	missense	probably benign
IGL01767:Adgrb3	APN	1	25559814	missense	probably benign	0.00
IGL01987:Adgrb3	APN	1	25101431	critical splice donor site	probably null
IGL02201:Adgrb3	APN	1	25420550	splice site	probably benign
IGL02584:Adgrb3	APN	1	25504984	missense	probably damaging	0.98
IGL02685:Adgrb3	APN	1	25084242	critical splice donor site	probably null
IGL02886:Adgrb3	APN	1	25504910	splice site	probably null
IGL02929:Adgrb3	APN	1	25553824	missense	probably benign	0.00
IGL03153:Adgrb3	APN	1	25531897	nonsense	probably null
IGL03165:Adgrb3	APN	1	25094394	missense	probably benign	0.05
IGL03227:Adgrb3	APN	1	25547475	missense	probably damaging	1.00
IGL03392:Adgrb3	APN	1	25504448	missense	probably damaging	0.99
schwach	UTSW	1	25111691	critical splice donor site	probably null
R0007:Adgrb3	UTSW	1	25111691	critical splice donor site	probably null
R0048:Adgrb3	UTSW	1	25101482	missense	probably benign	0.02
R0048:Adgrb3	UTSW	1	25101482	missense	probably benign	0.02
R0322:Adgrb3	UTSW	1	25221748	splice site	probably benign
R0442:Adgrb3	UTSW	1	25396470	missense	probably damaging	0.96
R0563:Adgrb3	UTSW	1	25547554	missense	probably damaging	0.99
R1168:Adgrb3	UTSW	1	25826199	missense	probably benign
R1252:Adgrb3	UTSW	1	25128828	missense	probably damaging	1.00
R1264:Adgrb3	UTSW	1	25559850	missense	probably damaging	0.97
R1543:Adgrb3	UTSW	1	25488088	missense	probably benign	0.01
R1577:Adgrb3	UTSW	1	25094183	missense	possibly damaging	0.51
R1581:Adgrb3	UTSW	1	25094072	missense	possibly damaging	0.94
R1583:Adgrb3	UTSW	1	25226831	splice site	probably null
R1653:Adgrb3	UTSW	1	25101503	missense	probably benign	0.09
R1725:Adgrb3	UTSW	1	25826300	missense	probably damaging	1.00
R1792:Adgrb3	UTSW	1	25228471	missense	probably damaging	1.00
R1827:Adgrb3	UTSW	1	25532577	missense	probably damaging	0.99
R1869:Adgrb3	UTSW	1	25826438	missense	possibly damaging	0.83
R1971:Adgrb3	UTSW	1	25547444	missense	probably benign	0.02
R2005:Adgrb3	UTSW	1	25111718	missense	probably benign	0.25
R2134:Adgrb3	UTSW	1	25093957	missense	probably damaging	0.99
R2142:Adgrb3	UTSW	1	25068209	missense	probably damaging	1.00
R2268:Adgrb3	UTSW	1	25111817	missense	possibly damaging	0.79
R3740:Adgrb3	UTSW	1	25826454	missense	probably benign	0.00
R3877:Adgrb3	UTSW	1	25111825	missense	probably damaging	1.00
R4120:Adgrb3	UTSW	1	25094307	nonsense	probably null
R4344:Adgrb3	UTSW	1	25826748	missense	possibly damaging	0.61
R4363:Adgrb3	UTSW	1	25112222	missense	probably damaging	1.00
R4438:Adgrb3	UTSW	1	25831027	unclassified	probably benign
R4465:Adgrb3	UTSW	1	25094366	missense	probably damaging	1.00
R4480:Adgrb3	UTSW	1	25111748	missense	probably damaging	1.00
R4554:Adgrb3	UTSW	1	25084279	missense	probably damaging	1.00
R4557:Adgrb3	UTSW	1	25084279	missense	probably damaging	1.00
R4622:Adgrb3	UTSW	1	25826488	missense	probably damaging	0.99
R4713:Adgrb3	UTSW	1	25547532	missense	probably damaging	1.00
R4772:Adgrb3	UTSW	1	25531875	missense	probably damaging	1.00
R4890:Adgrb3	UTSW	1	25221827	missense	probably damaging	1.00
R5045:Adgrb3	UTSW	1	25074779	missense	probably damaging	1.00
R5061:Adgrb3	UTSW	1	25068128	utr 3 prime	probably benign
R5097:Adgrb3	UTSW	1	25826084	missense	probably damaging	1.00
R5227:Adgrb3	UTSW	1	25093952	missense	possibly damaging	0.55
R5241:Adgrb3	UTSW	1	25111790	missense	possibly damaging	0.85
R5328:Adgrb3	UTSW	1	25094275	missense	possibly damaging	0.90
R5372:Adgrb3	UTSW	1	25128859	missense	probably benign	0.01
R5703:Adgrb3	UTSW	1	25420559	missense	probably damaging	1.00
R5747:Adgrb3	UTSW	1	25826562	missense	probably damaging	1.00
R5998:Adgrb3	UTSW	1	25431501	splice site	probably null
R6006:Adgrb3	UTSW	1	25826531	missense	possibly damaging	0.85
R6077:Adgrb3	UTSW	1	25094000	nonsense	probably null
R6183:Adgrb3	UTSW	1	25094370	missense	probably damaging	0.98
R6190:Adgrb3	UTSW	1	25420647	missense	probably benign	0.01
R6249:Adgrb3	UTSW	1	25432558	missense	probably damaging	1.00
R6310:Adgrb3	UTSW	1	25111718	missense	probably benign	0.13
R6450:Adgrb3	UTSW	1	25420602	missense	probably benign
R6678:Adgrb3	UTSW	1	25460810	missense	possibly damaging	0.84
R6679:Adgrb3	UTSW	1	25131296	missense	probably benign	0.01
R6685:Adgrb3	UTSW	1	25111736	nonsense	probably null
R6730:Adgrb3	UTSW	1	25094294	missense	probably damaging	1.00
R6805:Adgrb3	UTSW	1	25826172	missense	possibly damaging	0.83
R6847:Adgrb3	UTSW	1	25093922	missense	probably benign	0.03
R6929:Adgrb3	UTSW	1	25111771	nonsense	probably null
R6953:Adgrb3	UTSW	1	25826511	missense	probably damaging	1.00
R7062:Adgrb3	UTSW	1	25826085	missense	possibly damaging	0.90
R7244:Adgrb3	UTSW	1	25131269	missense	probably damaging	1.00
R7292:Adgrb3	UTSW	1	25531876	missense	probably damaging	1.00
R7325:Adgrb3	UTSW	1	25532630	missense	probably benign	0.01
R7378:Adgrb3	UTSW	1	25531919	nonsense	probably null
R7489:Adgrb3	UTSW	1	25547505	missense	probably damaging	1.00
R7615:Adgrb3	UTSW	1	25098897	missense	probably damaging	1.00
R7623:Adgrb3	UTSW	1	25547548	missense	probably damaging	1.00
R7787:Adgrb3	UTSW	1	25432544	missense	probably damaging	1.00
R7837:Adgrb3	UTSW	1	25128834	missense	probably damaging	1.00
R8064:Adgrb3	UTSW	1	25420556	critical splice donor site	probably null
R8152:Adgrb3	UTSW	1	25221757	splice site	probably null
R8161:Adgrb3	UTSW	1	25093922	missense	probably benign	0.03
R8225:Adgrb3	UTSW	1	25826516	missense	probably benign	0.00
R8417:Adgrb3	UTSW	1	25488053	missense	probably benign	0.21
R8694:Adgrb3	UTSW	1	25826391	missense	probably damaging	0.98
R8742:Adgrb3	UTSW	1	25226754	missense	probably benign	0.01
R8886:Adgrb3	UTSW	1	25111847	missense	probably damaging	1.00
R8941:Adgrb3	UTSW	1	25094154	missense	probably damaging	1.00
R8958:Adgrb3	UTSW	1	25826109	missense	possibly damaging	0.68
R8979:Adgrb3	UTSW	1	25488034	missense	probably benign	0.03
R9064:Adgrb3	UTSW	1	25531884	missense	possibly damaging	0.86
R9252:Adgrb3	UTSW	1	25826415	missense	probably benign	0.03
R9401:Adgrb3	UTSW	1	25553702	missense	probably damaging	1.00
R9739:Adgrb3	UTSW	1	25553768	missense	probably damaging	1.00
Z1088:Adgrb3	UTSW	1	25131271	missense	probably damaging	1.00
Z1176:Adgrb3	UTSW	1	25093914	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- TCCTTGGAGGAGTCATCACAAC -3'
(R):5'- CCTCTACCTTTAAGTGAAGTTCGAG -3'

Sequencing Primer
(F):5'- TGGAGGAGTCATCACAACTCTAAATC -3'
(R):5'- TTTAAGTGAAGTTCGAGGTGAAAATG -3'

Posted On

2014-06-23