Incidental Mutation 'R1838:Adgrb3'
ID205452
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
MMRRC Submission 039865-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #R1838 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25084270 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1417 (S1417P)
Ref Sequence ENSEMBL: ENSMUSP00000116231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect probably damaging
Transcript: ENSMUST00000041838
AA Change: S1417P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: S1417P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126626
AA Change: S547P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569
AA Change: S547P

DomainStartEndE-ValueType
Pfam:7tm_2 4 273 7.3e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135518
AA Change: S1417P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: S1417P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146592
AA Change: S1177P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: S1177P

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151309
AA Change: S1417P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: S1417P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153568
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,727 D22G unknown Het
Abca4 G A 3: 122,128,305 R1170K probably benign Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adamtsl3 G T 7: 82,493,373 R267L probably damaging Het
Adgrb2 A T 4: 130,010,231 T717S probably benign Het
Afg3l2 A T 18: 67,414,172 V561D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Btnl6 T A 17: 34,515,542 D82V probably damaging Het
Ccdc178 A G 18: 22,067,638 Y421H probably damaging Het
Cdc123 A T 2: 5,794,891 probably null Het
Cdhr5 C T 7: 141,272,603 V367I possibly damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Ctnna2 T C 6: 77,845,542 D26G probably damaging Het
Ctr9 G T 7: 111,052,303 R910L possibly damaging Het
Cyp2t4 G T 7: 27,158,416 R455L possibly damaging Het
Cyp3a13 A T 5: 137,911,632 probably null Het
Dennd3 T C 15: 73,565,100 S1059P probably damaging Het
Dennd4c A G 4: 86,825,178 T1135A probably benign Het
Dnah7b T C 1: 46,116,177 V295A probably benign Het
Dnah7b C A 1: 46,277,105 T3126K probably damaging Het
Ehbp1l1 C T 19: 5,717,691 E1195K probably benign Het
Exoc6b T A 6: 84,853,678 I447L probably benign Het
Glt1d1 G A 5: 127,678,129 V202I probably benign Het
Grk1 T C 8: 13,416,155 V533A possibly damaging Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Gzma T A 13: 113,095,984 I131F probably damaging Het
Helq A T 5: 100,771,879 L35* probably null Het
Hnrnpll T C 17: 80,038,623 N403S probably damaging Het
Hsf5 A G 11: 87,636,055 K518E probably benign Het
Ighe T A 12: 113,271,850 H258L unknown Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Ints13 C T 6: 146,566,611 A129T possibly damaging Het
Ipo7 T A 7: 110,042,109 H345Q probably damaging Het
Kcna2 A T 3: 107,104,512 E136D probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krtap4-9 A G 11: 99,785,396 probably benign Het
Lamc3 T C 2: 31,925,582 S1097P possibly damaging Het
Ldlrad2 A T 4: 137,572,170 N114K probably benign Het
Lrfn1 A T 7: 28,459,768 I371L probably damaging Het
Lrwd1 A G 5: 136,132,388 V240A probably benign Het
Lypd1 A T 1: 125,873,371 probably benign Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Man2c1 A G 9: 57,137,337 N354S probably benign Het
Map3k13 T C 16: 21,914,189 Y514H possibly damaging Het
Med15 T C 16: 17,653,562 D577G probably benign Het
Mroh4 A T 15: 74,616,113 M320K probably benign Het
Ms4a10 T A 19: 10,964,047 D186V possibly damaging Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Myo5c A T 9: 75,273,553 R741S probably damaging Het
Naip6 T C 13: 100,316,136 D139G probably damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Olfr1252 A T 2: 89,721,709 M134K probably damaging Het
Olfr1370 A T 13: 21,072,425 L292* probably null Het
Olfr229 A T 9: 39,909,841 I13F possibly damaging Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Pcdhb3 A G 18: 37,301,317 D112G probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Pgm3 C T 9: 86,569,233 V123I probably benign Het
Pms1 A C 1: 53,192,098 probably null Het
Prl2b1 A G 13: 27,388,566 S14P possibly damaging Het
Prune2 T A 19: 17,199,878 W212R probably damaging Het
Rabgef1 A G 5: 130,213,021 E422G probably benign Het
Ralyl A G 3: 14,143,412 E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,651,680 probably benign Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Slc16a7 C T 10: 125,231,198 V191M probably damaging Het
Slc34a2 A T 5: 53,058,436 H63L probably benign Het
Smpd4 G A 16: 17,642,302 probably null Het
Sp3 A G 2: 72,938,176 S748P possibly damaging Het
Spata31d1b G A 13: 59,715,857 C273Y probably benign Het
Spata31d1b G A 13: 59,717,465 R809K probably benign Het
Tmco5 A T 2: 116,880,879 E90V probably damaging Het
Tnxb A T 17: 34,678,910 D844V probably damaging Het
Tpi1 T C 6: 124,814,152 T41A probably benign Het
Ttn T C 2: 76,727,192 I29853V probably damaging Het
Vmn2r26 C T 6: 124,024,771 T5I probably benign Het
Wdr95 A G 5: 149,599,366 D663G probably benign Het
Zbtb39 T C 10: 127,742,700 F381S probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp646 T A 7: 127,879,739 Y363N probably damaging Het
Zfp712 A C 13: 67,042,047 C139G probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25826085 missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25131269 missense probably damaging 1.00
R7292:Adgrb3 UTSW 1 25531876 missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25532630 missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25531919 nonsense probably null
R7489:Adgrb3 UTSW 1 25547505 missense probably damaging 1.00
R7615:Adgrb3 UTSW 1 25098897 missense probably damaging 1.00
R7623:Adgrb3 UTSW 1 25547548 missense probably damaging 1.00
R7787:Adgrb3 UTSW 1 25432544 missense probably damaging 1.00
R7837:Adgrb3 UTSW 1 25128834 missense probably damaging 1.00
R8064:Adgrb3 UTSW 1 25420556 critical splice donor site probably null
R8152:Adgrb3 UTSW 1 25221757 splice site probably null
R8161:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R8225:Adgrb3 UTSW 1 25826516 missense probably benign 0.00
R8417:Adgrb3 UTSW 1 25488053 missense probably benign 0.21
R8694:Adgrb3 UTSW 1 25826391 missense probably damaging 0.98
R8742:Adgrb3 UTSW 1 25226754 missense probably benign 0.01
R8886:Adgrb3 UTSW 1 25111847 missense probably damaging 1.00
R8941:Adgrb3 UTSW 1 25094154 missense probably damaging 1.00
R8958:Adgrb3 UTSW 1 25826109 missense possibly damaging 0.68
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Z1176:Adgrb3 UTSW 1 25093914 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCCTTGGAGGAGTCATCACAAC -3'
(R):5'- CCTCTACCTTTAAGTGAAGTTCGAG -3'

Sequencing Primer
(F):5'- TGGAGGAGTCATCACAACTCTAAATC -3'
(R):5'- TTTAAGTGAAGTTCGAGGTGAAAATG -3'
Posted On2014-06-23