Incidental Mutation 'R1838:Pms1'
ID 205455
Institutional Source Beutler Lab
Gene Symbol Pms1
Ensembl Gene ENSMUSG00000026098
Gene Name PMS1 homolog 1, mismatch repair system component
Synonyms
MMRRC Submission 039865-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1838 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 53228346-53336177 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 53231257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027267] [ENSMUST00000072235] [ENSMUST00000190748]
AlphaFold Q8K119
Predicted Effect probably null
Transcript: ENSMUST00000027267
SMART Domains Protein: ENSMUSP00000027267
Gene: ENSMUSG00000026098

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072235
SMART Domains Protein: ENSMUSP00000072089
Gene: ENSMUSG00000060715

DomainStartEndE-ValueType
coiled coil region 38 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190748
SMART Domains Protein: ENSMUSP00000139938
Gene: ENSMUSG00000060715

DomainStartEndE-ValueType
coiled coil region 38 68 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191402
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a modest increase in DNA mismatch repair errors, primarily single base pair substitutions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,603,690 (GRCm39) D22G unknown Het
Abca4 G A 3: 121,921,954 (GRCm39) R1170K probably benign Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adamtsl3 G T 7: 82,142,581 (GRCm39) R267L probably damaging Het
Adgrb2 A T 4: 129,904,024 (GRCm39) T717S probably benign Het
Adgrb3 A G 1: 25,123,351 (GRCm39) S1417P probably damaging Het
Afg3l2 A T 18: 67,547,242 (GRCm39) V561D probably damaging Het
Atp13a2 T A 4: 140,721,643 (GRCm39) Y244* probably null Het
BB014433 C G 8: 15,092,629 (GRCm39) V75L unknown Het
Btnl6 T A 17: 34,734,516 (GRCm39) D82V probably damaging Het
Ccdc178 A G 18: 22,200,695 (GRCm39) Y421H probably damaging Het
Cdc123 A T 2: 5,799,702 (GRCm39) probably null Het
Cdhr5 C T 7: 140,852,516 (GRCm39) V367I possibly damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Ctnna2 T C 6: 77,822,525 (GRCm39) D26G probably damaging Het
Ctr9 G T 7: 110,651,510 (GRCm39) R910L possibly damaging Het
Cyp2t4 G T 7: 26,857,841 (GRCm39) R455L possibly damaging Het
Cyp3a13 A T 5: 137,909,894 (GRCm39) probably null Het
Dennd3 T C 15: 73,436,949 (GRCm39) S1059P probably damaging Het
Dennd4c A G 4: 86,743,415 (GRCm39) T1135A probably benign Het
Dnah7b T C 1: 46,155,337 (GRCm39) V295A probably benign Het
Dnah7b C A 1: 46,316,265 (GRCm39) T3126K probably damaging Het
Ehbp1l1 C T 19: 5,767,719 (GRCm39) E1195K probably benign Het
Exoc6b T A 6: 84,830,660 (GRCm39) I447L probably benign Het
Glt1d1 G A 5: 127,755,193 (GRCm39) V202I probably benign Het
Grk1 T C 8: 13,466,155 (GRCm39) V533A possibly damaging Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Gzma T A 13: 113,232,518 (GRCm39) I131F probably damaging Het
Helq A T 5: 100,919,745 (GRCm39) L35* probably null Het
Hnrnpll T C 17: 80,346,052 (GRCm39) N403S probably damaging Het
Hsf5 A G 11: 87,526,881 (GRCm39) K518E probably benign Het
Ighe T A 12: 113,235,470 (GRCm39) H258L unknown Het
Il6ra T C 3: 89,797,579 (GRCm39) D96G probably benign Het
Ints13 C T 6: 146,468,109 (GRCm39) A129T possibly damaging Het
Ipo7 T A 7: 109,641,316 (GRCm39) H345Q probably damaging Het
Kcna2 A T 3: 107,011,828 (GRCm39) E136D probably benign Het
Kif5a G A 10: 127,072,684 (GRCm39) Q702* probably null Het
Klhdc7a G T 4: 139,694,381 (GRCm39) P189T probably benign Het
Krtap4-9 A G 11: 99,676,222 (GRCm39) probably benign Het
Lamc3 T C 2: 31,815,594 (GRCm39) S1097P possibly damaging Het
Ldlrad2 A T 4: 137,299,481 (GRCm39) N114K probably benign Het
Lrfn1 A T 7: 28,159,193 (GRCm39) I371L probably damaging Het
Lrwd1 A G 5: 136,161,242 (GRCm39) V240A probably benign Het
Lypd1 A T 1: 125,801,108 (GRCm39) probably benign Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Man2c1 A G 9: 57,044,621 (GRCm39) N354S probably benign Het
Map3k13 T C 16: 21,732,939 (GRCm39) Y514H possibly damaging Het
Med15 T C 16: 17,471,426 (GRCm39) D577G probably benign Het
Mroh4 A T 15: 74,487,962 (GRCm39) M320K probably benign Het
Ms4a10 T A 19: 10,941,411 (GRCm39) D186V possibly damaging Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Myo5c A T 9: 75,180,835 (GRCm39) R741S probably damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Naip6 T C 13: 100,452,644 (GRCm39) D139G probably damaging Het
Or10s1 A T 9: 39,985,605 (GRCm39) M5L probably benign Het
Or2p2 A T 13: 21,256,595 (GRCm39) L292* probably null Het
Or4a79 A T 2: 89,552,053 (GRCm39) M134K probably damaging Het
Or8g2 A T 9: 39,821,137 (GRCm39) I13F possibly damaging Het
Pcdhb3 A G 18: 37,434,370 (GRCm39) D112G probably benign Het
Pdpr C A 8: 111,861,366 (GRCm39) P787T probably damaging Het
Pgm3 C T 9: 86,451,286 (GRCm39) V123I probably benign Het
Prl2b1 A G 13: 27,572,549 (GRCm39) S14P possibly damaging Het
Prune2 T A 19: 17,177,242 (GRCm39) W212R probably damaging Het
Rabgef1 A G 5: 130,241,862 (GRCm39) E422G probably benign Het
Ralyl A G 3: 14,208,472 (GRCm39) E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,558,962 (GRCm39) probably benign Het
Rit1 C G 3: 88,636,477 (GRCm39) T127S probably damaging Het
Slc16a7 C T 10: 125,067,067 (GRCm39) V191M probably damaging Het
Slc34a2 A T 5: 53,215,778 (GRCm39) H63L probably benign Het
Smpd4 G A 16: 17,460,166 (GRCm39) probably null Het
Sp3 A G 2: 72,768,520 (GRCm39) S748P possibly damaging Het
Spata31d1b G A 13: 59,863,671 (GRCm39) C273Y probably benign Het
Spata31d1b G A 13: 59,865,279 (GRCm39) R809K probably benign Het
Tmco5 A T 2: 116,711,360 (GRCm39) E90V probably damaging Het
Tnxb A T 17: 34,897,884 (GRCm39) D844V probably damaging Het
Tpi1 T C 6: 124,791,115 (GRCm39) T41A probably benign Het
Ttn T C 2: 76,557,536 (GRCm39) I29853V probably damaging Het
Vmn2r26 C T 6: 124,001,730 (GRCm39) T5I probably benign Het
Wdr95 A G 5: 149,522,831 (GRCm39) D663G probably benign Het
Zbtb39 T C 10: 127,578,569 (GRCm39) F381S probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp646 T A 7: 127,478,911 (GRCm39) Y363N probably damaging Het
Zfp712 A C 13: 67,190,111 (GRCm39) C139G probably damaging Het
Zfp958 A G 8: 4,678,590 (GRCm39) H205R probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Pms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Pms1 APN 1 53,245,715 (GRCm39) splice site probably benign
IGL00937:Pms1 APN 1 53,314,410 (GRCm39) missense possibly damaging 0.74
IGL01505:Pms1 APN 1 53,246,130 (GRCm39) missense probably benign
IGL02109:Pms1 APN 1 53,246,568 (GRCm39) missense probably damaging 0.96
IGL02245:Pms1 APN 1 53,246,519 (GRCm39) missense probably damaging 1.00
IGL02273:Pms1 APN 1 53,247,156 (GRCm39) missense probably damaging 1.00
IGL02339:Pms1 APN 1 53,314,324 (GRCm39) missense possibly damaging 0.78
R0157:Pms1 UTSW 1 53,234,196 (GRCm39) nonsense probably null
R0530:Pms1 UTSW 1 53,235,972 (GRCm39) splice site probably null
R1398:Pms1 UTSW 1 53,246,435 (GRCm39) missense possibly damaging 0.88
R1817:Pms1 UTSW 1 53,246,128 (GRCm39) missense probably benign 0.02
R1831:Pms1 UTSW 1 53,246,370 (GRCm39) missense probably benign 0.00
R1867:Pms1 UTSW 1 53,228,546 (GRCm39) missense probably benign 0.36
R1874:Pms1 UTSW 1 53,246,392 (GRCm39) missense probably benign 0.16
R1939:Pms1 UTSW 1 53,236,135 (GRCm39) missense probably damaging 1.00
R1991:Pms1 UTSW 1 53,321,201 (GRCm39) missense probably damaging 1.00
R1993:Pms1 UTSW 1 53,234,174 (GRCm39) missense probably benign
R1995:Pms1 UTSW 1 53,234,174 (GRCm39) missense probably benign
R2049:Pms1 UTSW 1 53,321,147 (GRCm39) missense probably damaging 0.99
R2058:Pms1 UTSW 1 53,314,327 (GRCm39) missense probably benign 0.00
R2140:Pms1 UTSW 1 53,321,147 (GRCm39) missense probably damaging 0.99
R4078:Pms1 UTSW 1 53,306,948 (GRCm39) splice site probably null
R4608:Pms1 UTSW 1 53,234,097 (GRCm39) missense possibly damaging 0.80
R4668:Pms1 UTSW 1 53,228,633 (GRCm39) nonsense probably null
R5164:Pms1 UTSW 1 53,246,799 (GRCm39) missense probably damaging 0.99
R5200:Pms1 UTSW 1 53,245,916 (GRCm39) missense probably benign 0.00
R5397:Pms1 UTSW 1 53,231,279 (GRCm39) nonsense probably null
R5745:Pms1 UTSW 1 53,246,861 (GRCm39) nonsense probably null
R6440:Pms1 UTSW 1 53,234,180 (GRCm39) missense probably damaging 0.98
R6445:Pms1 UTSW 1 53,231,353 (GRCm39) missense possibly damaging 0.77
R6802:Pms1 UTSW 1 53,245,951 (GRCm39) missense probably benign 0.06
R6975:Pms1 UTSW 1 53,228,590 (GRCm39) missense probably damaging 0.99
R7020:Pms1 UTSW 1 53,228,541 (GRCm39) missense probably damaging 1.00
R7037:Pms1 UTSW 1 53,246,770 (GRCm39) missense possibly damaging 0.95
R7199:Pms1 UTSW 1 53,295,889 (GRCm39) missense probably benign 0.02
R7417:Pms1 UTSW 1 53,236,231 (GRCm39) missense probably benign 0.00
R7587:Pms1 UTSW 1 53,246,475 (GRCm39) missense probably benign 0.00
R7716:Pms1 UTSW 1 53,246,767 (GRCm39) missense probably damaging 1.00
R8178:Pms1 UTSW 1 53,246,505 (GRCm39) missense probably benign 0.00
R8336:Pms1 UTSW 1 53,245,985 (GRCm39) missense probably benign
R8399:Pms1 UTSW 1 53,307,091 (GRCm39) critical splice acceptor site probably null
R8692:Pms1 UTSW 1 53,246,052 (GRCm39) missense probably benign
R8736:Pms1 UTSW 1 53,307,053 (GRCm39) missense possibly damaging 0.63
R8738:Pms1 UTSW 1 53,321,195 (GRCm39) missense possibly damaging 0.67
R8751:Pms1 UTSW 1 53,231,269 (GRCm39) missense probably benign 0.01
R9102:Pms1 UTSW 1 53,307,021 (GRCm39) missense probably benign 0.11
R9294:Pms1 UTSW 1 53,247,216 (GRCm39) missense probably benign
R9648:Pms1 UTSW 1 53,314,284 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTCGCTCAGAAACTTCTCAG -3'
(R):5'- CCTCAGGAGTTTCCAGTACTG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CTCAGGAGTTTCCAGTACTGAGAAC -3'
Posted On 2014-06-23