Incidental Mutation 'R1838:Lamc3'
ID 205458
Institutional Source Beutler Lab
Gene Symbol Lamc3
Ensembl Gene ENSMUSG00000026840
Gene Name laminin gamma 3
Synonyms
MMRRC Submission 039865-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1838 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 31777303-31836551 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31815594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1097 (S1097P)
Ref Sequence ENSEMBL: ENSMUSP00000028187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]
AlphaFold Q9R0B6
Predicted Effect possibly damaging
Transcript: ENSMUST00000028187
AA Change: S1097P

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: S1097P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1234 1247 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
coiled coil region 1444 1467 N/A INTRINSIC
coiled coil region 1528 1575 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135995
Predicted Effect possibly damaging
Transcript: ENSMUST00000138325
AA Change: S1097P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: S1097P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
coiled coil region 1455 1478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,603,690 (GRCm39) D22G unknown Het
Abca4 G A 3: 121,921,954 (GRCm39) R1170K probably benign Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adamtsl3 G T 7: 82,142,581 (GRCm39) R267L probably damaging Het
Adgrb2 A T 4: 129,904,024 (GRCm39) T717S probably benign Het
Adgrb3 A G 1: 25,123,351 (GRCm39) S1417P probably damaging Het
Afg3l2 A T 18: 67,547,242 (GRCm39) V561D probably damaging Het
Atp13a2 T A 4: 140,721,643 (GRCm39) Y244* probably null Het
BB014433 C G 8: 15,092,629 (GRCm39) V75L unknown Het
Btnl6 T A 17: 34,734,516 (GRCm39) D82V probably damaging Het
Ccdc178 A G 18: 22,200,695 (GRCm39) Y421H probably damaging Het
Cdc123 A T 2: 5,799,702 (GRCm39) probably null Het
Cdhr5 C T 7: 140,852,516 (GRCm39) V367I possibly damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Ctnna2 T C 6: 77,822,525 (GRCm39) D26G probably damaging Het
Ctr9 G T 7: 110,651,510 (GRCm39) R910L possibly damaging Het
Cyp2t4 G T 7: 26,857,841 (GRCm39) R455L possibly damaging Het
Cyp3a13 A T 5: 137,909,894 (GRCm39) probably null Het
Dennd3 T C 15: 73,436,949 (GRCm39) S1059P probably damaging Het
Dennd4c A G 4: 86,743,415 (GRCm39) T1135A probably benign Het
Dnah7b T C 1: 46,155,337 (GRCm39) V295A probably benign Het
Dnah7b C A 1: 46,316,265 (GRCm39) T3126K probably damaging Het
Ehbp1l1 C T 19: 5,767,719 (GRCm39) E1195K probably benign Het
Exoc6b T A 6: 84,830,660 (GRCm39) I447L probably benign Het
Glt1d1 G A 5: 127,755,193 (GRCm39) V202I probably benign Het
Grk1 T C 8: 13,466,155 (GRCm39) V533A possibly damaging Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Gzma T A 13: 113,232,518 (GRCm39) I131F probably damaging Het
Helq A T 5: 100,919,745 (GRCm39) L35* probably null Het
Hnrnpll T C 17: 80,346,052 (GRCm39) N403S probably damaging Het
Hsf5 A G 11: 87,526,881 (GRCm39) K518E probably benign Het
Ighe T A 12: 113,235,470 (GRCm39) H258L unknown Het
Il6ra T C 3: 89,797,579 (GRCm39) D96G probably benign Het
Ints13 C T 6: 146,468,109 (GRCm39) A129T possibly damaging Het
Ipo7 T A 7: 109,641,316 (GRCm39) H345Q probably damaging Het
Kcna2 A T 3: 107,011,828 (GRCm39) E136D probably benign Het
Kif5a G A 10: 127,072,684 (GRCm39) Q702* probably null Het
Klhdc7a G T 4: 139,694,381 (GRCm39) P189T probably benign Het
Krtap4-9 A G 11: 99,676,222 (GRCm39) probably benign Het
Ldlrad2 A T 4: 137,299,481 (GRCm39) N114K probably benign Het
Lrfn1 A T 7: 28,159,193 (GRCm39) I371L probably damaging Het
Lrwd1 A G 5: 136,161,242 (GRCm39) V240A probably benign Het
Lypd1 A T 1: 125,801,108 (GRCm39) probably benign Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Man2c1 A G 9: 57,044,621 (GRCm39) N354S probably benign Het
Map3k13 T C 16: 21,732,939 (GRCm39) Y514H possibly damaging Het
Med15 T C 16: 17,471,426 (GRCm39) D577G probably benign Het
Mroh4 A T 15: 74,487,962 (GRCm39) M320K probably benign Het
Ms4a10 T A 19: 10,941,411 (GRCm39) D186V possibly damaging Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Myo5c A T 9: 75,180,835 (GRCm39) R741S probably damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Naip6 T C 13: 100,452,644 (GRCm39) D139G probably damaging Het
Or10s1 A T 9: 39,985,605 (GRCm39) M5L probably benign Het
Or2p2 A T 13: 21,256,595 (GRCm39) L292* probably null Het
Or4a79 A T 2: 89,552,053 (GRCm39) M134K probably damaging Het
Or8g2 A T 9: 39,821,137 (GRCm39) I13F possibly damaging Het
Pcdhb3 A G 18: 37,434,370 (GRCm39) D112G probably benign Het
Pdpr C A 8: 111,861,366 (GRCm39) P787T probably damaging Het
Pgm3 C T 9: 86,451,286 (GRCm39) V123I probably benign Het
Pms1 A C 1: 53,231,257 (GRCm39) probably null Het
Prl2b1 A G 13: 27,572,549 (GRCm39) S14P possibly damaging Het
Prune2 T A 19: 17,177,242 (GRCm39) W212R probably damaging Het
Rabgef1 A G 5: 130,241,862 (GRCm39) E422G probably benign Het
Ralyl A G 3: 14,208,472 (GRCm39) E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,558,962 (GRCm39) probably benign Het
Rit1 C G 3: 88,636,477 (GRCm39) T127S probably damaging Het
Slc16a7 C T 10: 125,067,067 (GRCm39) V191M probably damaging Het
Slc34a2 A T 5: 53,215,778 (GRCm39) H63L probably benign Het
Smpd4 G A 16: 17,460,166 (GRCm39) probably null Het
Sp3 A G 2: 72,768,520 (GRCm39) S748P possibly damaging Het
Spata31d1b G A 13: 59,863,671 (GRCm39) C273Y probably benign Het
Spata31d1b G A 13: 59,865,279 (GRCm39) R809K probably benign Het
Tmco5 A T 2: 116,711,360 (GRCm39) E90V probably damaging Het
Tnxb A T 17: 34,897,884 (GRCm39) D844V probably damaging Het
Tpi1 T C 6: 124,791,115 (GRCm39) T41A probably benign Het
Ttn T C 2: 76,557,536 (GRCm39) I29853V probably damaging Het
Vmn2r26 C T 6: 124,001,730 (GRCm39) T5I probably benign Het
Wdr95 A G 5: 149,522,831 (GRCm39) D663G probably benign Het
Zbtb39 T C 10: 127,578,569 (GRCm39) F381S probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp646 T A 7: 127,478,911 (GRCm39) Y363N probably damaging Het
Zfp712 A C 13: 67,190,111 (GRCm39) C139G probably damaging Het
Zfp958 A G 8: 4,678,590 (GRCm39) H205R probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Lamc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Lamc3 APN 2 31,790,593 (GRCm39) missense probably damaging 0.99
IGL00823:Lamc3 APN 2 31,808,533 (GRCm39) missense probably damaging 1.00
IGL01020:Lamc3 APN 2 31,804,668 (GRCm39) missense probably benign 0.07
IGL01086:Lamc3 APN 2 31,788,488 (GRCm39) missense probably damaging 1.00
IGL01618:Lamc3 APN 2 31,802,119 (GRCm39) missense probably damaging 0.99
IGL01655:Lamc3 APN 2 31,788,290 (GRCm39) missense probably damaging 1.00
IGL02093:Lamc3 APN 2 31,777,667 (GRCm39) missense probably damaging 1.00
IGL02309:Lamc3 APN 2 31,804,616 (GRCm39) splice site probably benign
IGL02340:Lamc3 APN 2 31,808,469 (GRCm39) missense probably damaging 1.00
IGL02410:Lamc3 APN 2 31,795,977 (GRCm39) missense probably damaging 0.99
IGL02548:Lamc3 APN 2 31,810,674 (GRCm39) missense probably benign 0.00
IGL02679:Lamc3 APN 2 31,835,410 (GRCm39) missense probably benign 0.01
IGL02751:Lamc3 APN 2 31,810,716 (GRCm39) missense probably benign 0.07
IGL02820:Lamc3 APN 2 31,813,034 (GRCm39) missense probably damaging 1.00
IGL02926:Lamc3 APN 2 31,825,738 (GRCm39) splice site probably benign
IGL02926:Lamc3 APN 2 31,825,737 (GRCm39) splice site probably benign
IGL03090:Lamc3 APN 2 31,798,710 (GRCm39) splice site probably benign
IGL03258:Lamc3 APN 2 31,777,695 (GRCm39) missense probably damaging 1.00
R0005:Lamc3 UTSW 2 31,812,440 (GRCm39) missense probably benign 0.07
R0137:Lamc3 UTSW 2 31,798,628 (GRCm39) missense probably damaging 1.00
R0179:Lamc3 UTSW 2 31,805,096 (GRCm39) splice site probably benign
R0244:Lamc3 UTSW 2 31,830,733 (GRCm39) missense probably damaging 1.00
R0512:Lamc3 UTSW 2 31,827,980 (GRCm39) missense probably damaging 1.00
R1052:Lamc3 UTSW 2 31,818,814 (GRCm39) missense probably benign 0.03
R1142:Lamc3 UTSW 2 31,830,733 (GRCm39) missense probably damaging 1.00
R1366:Lamc3 UTSW 2 31,818,859 (GRCm39) missense probably damaging 1.00
R1463:Lamc3 UTSW 2 31,777,423 (GRCm39) missense probably benign
R1515:Lamc3 UTSW 2 31,830,763 (GRCm39) missense probably damaging 1.00
R1642:Lamc3 UTSW 2 31,806,008 (GRCm39) missense probably damaging 1.00
R1692:Lamc3 UTSW 2 31,811,793 (GRCm39) missense probably null 0.01
R1707:Lamc3 UTSW 2 31,802,141 (GRCm39) critical splice donor site probably null
R1714:Lamc3 UTSW 2 31,830,769 (GRCm39) missense probably benign 0.02
R2940:Lamc3 UTSW 2 31,830,714 (GRCm39) missense probably benign 0.02
R3177:Lamc3 UTSW 2 31,798,637 (GRCm39) missense probably damaging 1.00
R3277:Lamc3 UTSW 2 31,798,637 (GRCm39) missense probably damaging 1.00
R3846:Lamc3 UTSW 2 31,814,604 (GRCm39) missense probably benign 0.01
R4065:Lamc3 UTSW 2 31,835,270 (GRCm39) missense probably benign 0.00
R4089:Lamc3 UTSW 2 31,810,520 (GRCm39) nonsense probably null
R4373:Lamc3 UTSW 2 31,788,244 (GRCm39) missense probably damaging 1.00
R4394:Lamc3 UTSW 2 31,821,964 (GRCm39) missense probably benign
R4395:Lamc3 UTSW 2 31,821,964 (GRCm39) missense probably benign
R4397:Lamc3 UTSW 2 31,821,964 (GRCm39) missense probably benign
R4746:Lamc3 UTSW 2 31,795,626 (GRCm39) missense possibly damaging 0.77
R4948:Lamc3 UTSW 2 31,830,748 (GRCm39) missense probably benign 0.02
R4960:Lamc3 UTSW 2 31,805,966 (GRCm39) missense probably benign 0.00
R5025:Lamc3 UTSW 2 31,798,681 (GRCm39) missense probably benign 0.13
R5062:Lamc3 UTSW 2 31,795,679 (GRCm39) missense possibly damaging 0.60
R5170:Lamc3 UTSW 2 31,777,356 (GRCm39) start codon destroyed probably benign 0.03
R5286:Lamc3 UTSW 2 31,808,608 (GRCm39) missense probably damaging 1.00
R5457:Lamc3 UTSW 2 31,821,997 (GRCm39) missense probably benign
R5655:Lamc3 UTSW 2 31,815,729 (GRCm39) missense probably benign 0.01
R5928:Lamc3 UTSW 2 31,811,721 (GRCm39) missense probably benign 0.00
R6018:Lamc3 UTSW 2 31,795,724 (GRCm39) missense probably damaging 1.00
R6479:Lamc3 UTSW 2 31,777,413 (GRCm39) missense probably benign
R6601:Lamc3 UTSW 2 31,810,544 (GRCm39) missense possibly damaging 0.94
R6920:Lamc3 UTSW 2 31,798,701 (GRCm39) missense probably damaging 1.00
R6924:Lamc3 UTSW 2 31,828,081 (GRCm39) missense probably benign
R7114:Lamc3 UTSW 2 31,820,657 (GRCm39) missense probably damaging 0.99
R7305:Lamc3 UTSW 2 31,820,714 (GRCm39) missense probably benign 0.39
R7559:Lamc3 UTSW 2 31,812,380 (GRCm39) missense probably benign 0.00
R7714:Lamc3 UTSW 2 31,812,279 (GRCm39) splice site probably null
R7787:Lamc3 UTSW 2 31,790,551 (GRCm39) missense probably damaging 0.99
R7819:Lamc3 UTSW 2 31,811,775 (GRCm39) missense probably benign
R8171:Lamc3 UTSW 2 31,804,983 (GRCm39) missense probably benign 0.06
R8208:Lamc3 UTSW 2 31,777,426 (GRCm39) missense possibly damaging 0.47
R8412:Lamc3 UTSW 2 31,802,128 (GRCm39) missense probably damaging 0.98
R9058:Lamc3 UTSW 2 31,798,653 (GRCm39) missense probably benign 0.01
R9242:Lamc3 UTSW 2 31,788,323 (GRCm39) missense probably benign 0.14
R9269:Lamc3 UTSW 2 31,818,908 (GRCm39) nonsense probably null
R9269:Lamc3 UTSW 2 31,813,017 (GRCm39) missense probably benign 0.11
X0010:Lamc3 UTSW 2 31,828,024 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGGGGTACTGGAAGCAGAG -3'
(R):5'- AAAGACTCCTACACGGGCTC -3'

Sequencing Primer
(F):5'- CAGAGGGGCAAAGTAGCTCTG -3'
(R):5'- CTCCAGAGGAAGCAGGGTTTG -3'
Posted On 2014-06-23