Mutagenetix > Incidental Mutation

Incidental Mutation 'R1838:Lamc3'

205458

Institutional Source

Beutler Lab

Gene Symbol

Lamc3

Ensembl Gene

ENSMUSG00000026840

Gene Name

laminin gamma 3

Synonyms

MMRRC Submission

039865-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31887291-31946539 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31925582 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1097 (S1097P)

Ref Sequence

ENSEMBL: ENSMUSP00000028187 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]

AlphaFold

Q9R0B6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028187
AA Change: S1097P

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: S1097P

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
LamNT	38	278	4.32e-115	SMART
EGF_Lam	280	333	4.19e-8	SMART
EGF_Lam	336	389	4.81e-8	SMART
EGF_Lam	392	436	2.52e-11	SMART
EGF_Lam	439	486	1.16e-10	SMART
low complexity region	538	549	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
EGF_like	649	716	3.69e0	SMART
EGF_Lam	719	764	3.1e-11	SMART
EGF_Lam	767	819	3.43e-4	SMART
EGF_Lam	822	875	2.16e-10	SMART
EGF_Lam	878	925	6.29e-12	SMART
EGF_Lam	928	973	1.62e-14	SMART
EGF_Lam	976	1021	1.02e-6	SMART
low complexity region	1032	1046	N/A	INTRINSIC
coiled coil region	1119	1150	N/A	INTRINSIC
low complexity region	1234	1247	N/A	INTRINSIC
low complexity region	1397	1407	N/A	INTRINSIC
coiled coil region	1444	1467	N/A	INTRINSIC
coiled coil region	1528	1575	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135995

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138325
AA Change: S1097P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: S1097P

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
LamNT	38	278	4.32e-115	SMART
EGF_Lam	280	333	4.19e-8	SMART
EGF_Lam	336	389	4.81e-8	SMART
EGF_Lam	392	436	2.52e-11	SMART
EGF_Lam	439	486	1.16e-10	SMART
low complexity region	538	549	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
EGF_like	649	716	3.69e0	SMART
EGF_Lam	719	764	3.1e-11	SMART
EGF_Lam	767	819	3.43e-4	SMART
EGF_Lam	822	875	2.16e-10	SMART
EGF_Lam	878	925	6.29e-12	SMART
EGF_Lam	928	973	1.62e-14	SMART
EGF_Lam	976	1021	1.02e-6	SMART
low complexity region	1032	1046	N/A	INTRINSIC
coiled coil region	1119	1150	N/A	INTRINSIC
low complexity region	1245	1258	N/A	INTRINSIC
low complexity region	1408	1418	N/A	INTRINSIC
coiled coil region	1455	1478	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	T	C	6: 132,626,727	D22G	unknown	Het
Abca4	G	A	3: 122,128,305	R1170K	probably benign	Het
Adam28	T	C	14: 68,639,210	N197S	possibly damaging	Het
Adamtsl3	G	T	7: 82,493,373	R267L	probably damaging	Het
Adgrb2	A	T	4: 130,010,231	T717S	probably benign	Het
Adgrb3	A	G	1: 25,084,270	S1417P	probably damaging	Het
Afg3l2	A	T	18: 67,414,172	V561D	probably damaging	Het
Atp13a2	T	A	4: 140,994,332	Y244*	probably null	Het
BB014433	C	G	8: 15,042,629	V75L	unknown	Het
Btnl6	T	A	17: 34,515,542	D82V	probably damaging	Het
Ccdc178	A	G	18: 22,067,638	Y421H	probably damaging	Het
Cdc123	A	T	2: 5,794,891		probably null	Het
Cdhr5	C	T	7: 141,272,603	V367I	possibly damaging	Het
Celsr3	A	G	9: 108,829,906	H1196R	probably benign	Het
Chd8	T	C	14: 52,204,883	S2077G	probably benign	Het
Col6a5	G	A	9: 105,864,833	H2296Y	probably benign	Het
Ctnna2	T	C	6: 77,845,542	D26G	probably damaging	Het
Ctr9	G	T	7: 111,052,303	R910L	possibly damaging	Het
Cyp2t4	G	T	7: 27,158,416	R455L	possibly damaging	Het
Cyp3a13	A	T	5: 137,911,632		probably null	Het
Dennd3	T	C	15: 73,565,100	S1059P	probably damaging	Het
Dennd4c	A	G	4: 86,825,178	T1135A	probably benign	Het
Dnah7b	T	C	1: 46,116,177	V295A	probably benign	Het
Dnah7b	C	A	1: 46,277,105	T3126K	probably damaging	Het
Ehbp1l1	C	T	19: 5,717,691	E1195K	probably benign	Het
Exoc6b	T	A	6: 84,853,678	I447L	probably benign	Het
Glt1d1	G	A	5: 127,678,129	V202I	probably benign	Het
Grk1	T	C	8: 13,416,155	V533A	possibly damaging	Het
Gsdma3	C	T	11: 98,629,858	A105V	probably benign	Het
Gzma	T	A	13: 113,095,984	I131F	probably damaging	Het
Helq	A	T	5: 100,771,879	L35*	probably null	Het
Hnrnpll	T	C	17: 80,038,623	N403S	probably damaging	Het
Hsf5	A	G	11: 87,636,055	K518E	probably benign	Het
Ighe	T	A	12: 113,271,850	H258L	unknown	Het
Il6ra	T	C	3: 89,890,272	D96G	probably benign	Het
Ints13	C	T	6: 146,566,611	A129T	possibly damaging	Het
Ipo7	T	A	7: 110,042,109	H345Q	probably damaging	Het
Kcna2	A	T	3: 107,104,512	E136D	probably benign	Het
Kif5a	G	A	10: 127,236,815	Q702*	probably null	Het
Klhdc7a	G	T	4: 139,967,070	P189T	probably benign	Het
Krtap4-9	A	G	11: 99,785,396		probably benign	Het
Ldlrad2	A	T	4: 137,572,170	N114K	probably benign	Het
Lrfn1	A	T	7: 28,459,768	I371L	probably damaging	Het
Lrwd1	A	G	5: 136,132,388	V240A	probably benign	Het
Lypd1	A	T	1: 125,873,371		probably benign	Het
Magi2	A	T	5: 20,465,827	T163S	probably damaging	Het
Man2c1	A	G	9: 57,137,337	N354S	probably benign	Het
Map3k13	T	C	16: 21,914,189	Y514H	possibly damaging	Het
Med15	T	C	16: 17,653,562	D577G	probably benign	Het
Mroh4	A	T	15: 74,616,113	M320K	probably benign	Het
Ms4a10	T	A	19: 10,964,047	D186V	possibly damaging	Het
Myh7	T	C	14: 54,973,180	N1725S	possibly damaging	Het
Myo5c	A	T	9: 75,273,553	R741S	probably damaging	Het
Naip6	T	C	13: 100,316,136	D139G	probably damaging	Het
Nat6	G	A	9: 107,583,017	R37H	possibly damaging	Het
Olfr1252	A	T	2: 89,721,709	M134K	probably damaging	Het
Olfr1370	A	T	13: 21,072,425	L292*	probably null	Het
Olfr229	A	T	9: 39,909,841	I13F	possibly damaging	Het
Olfr982	A	T	9: 40,074,309	M5L	probably benign	Het
Pcdhb3	A	G	18: 37,301,317	D112G	probably benign	Het
Pdpr	C	A	8: 111,134,734	P787T	probably damaging	Het
Pgm3	C	T	9: 86,569,233	V123I	probably benign	Het
Pms1	A	C	1: 53,192,098		probably null	Het
Prl2b1	A	G	13: 27,388,566	S14P	possibly damaging	Het
Prune2	T	A	19: 17,199,878	W212R	probably damaging	Het
Rabgef1	A	G	5: 130,213,021	E422G	probably benign	Het
Ralyl	A	G	3: 14,143,412	E204G	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rbpms2	TGCCGCCGCC	TGCCGCCGCCGCC	9: 65,651,680		probably benign	Het
Rit1	C	G	3: 88,729,170	T127S	probably damaging	Het
Slc16a7	C	T	10: 125,231,198	V191M	probably damaging	Het
Slc34a2	A	T	5: 53,058,436	H63L	probably benign	Het
Smpd4	G	A	16: 17,642,302		probably null	Het
Sp3	A	G	2: 72,938,176	S748P	possibly damaging	Het
Spata31d1b	G	A	13: 59,715,857	C273Y	probably benign	Het
Spata31d1b	G	A	13: 59,717,465	R809K	probably benign	Het
Tmco5	A	T	2: 116,880,879	E90V	probably damaging	Het
Tnxb	A	T	17: 34,678,910	D844V	probably damaging	Het
Tpi1	T	C	6: 124,814,152	T41A	probably benign	Het
Ttn	T	C	2: 76,727,192	I29853V	probably damaging	Het
Vmn2r26	C	T	6: 124,024,771	T5I	probably benign	Het
Wdr95	A	G	5: 149,599,366	D663G	probably benign	Het
Zbtb39	T	C	10: 127,742,700	F381S	probably damaging	Het
Zfp523	T	A	17: 28,194,993	I34N	probably damaging	Het
Zfp646	T	A	7: 127,879,739	Y363N	probably damaging	Het
Zfp712	A	C	13: 67,042,047	C139G	probably damaging	Het
Zfp958	A	G	8: 4,628,590	H205R	probably damaging	Het
Zfp974	G	A	7: 27,910,356	P648L	possibly damaging	Het

Other mutations in Lamc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Lamc3	APN	2	31900581	missense	probably damaging	0.99
IGL00823:Lamc3	APN	2	31918521	missense	probably damaging	1.00
IGL01020:Lamc3	APN	2	31914656	missense	probably benign	0.07
IGL01086:Lamc3	APN	2	31898476	missense	probably damaging	1.00
IGL01618:Lamc3	APN	2	31912107	missense	probably damaging	0.99
IGL01655:Lamc3	APN	2	31898278	missense	probably damaging	1.00
IGL02093:Lamc3	APN	2	31887655	missense	probably damaging	1.00
IGL02309:Lamc3	APN	2	31914604	splice site	probably benign
IGL02340:Lamc3	APN	2	31918457	missense	probably damaging	1.00
IGL02410:Lamc3	APN	2	31905965	missense	probably damaging	0.99
IGL02548:Lamc3	APN	2	31920662	missense	probably benign	0.00
IGL02679:Lamc3	APN	2	31945398	missense	probably benign	0.01
IGL02751:Lamc3	APN	2	31920704	missense	probably benign	0.07
IGL02820:Lamc3	APN	2	31923022	missense	probably damaging	1.00
IGL02926:Lamc3	APN	2	31935725	splice site	probably benign
IGL02926:Lamc3	APN	2	31935726	splice site	probably benign
IGL03090:Lamc3	APN	2	31908698	splice site	probably benign
IGL03258:Lamc3	APN	2	31887683	missense	probably damaging	1.00
R0005:Lamc3	UTSW	2	31922428	missense	probably benign	0.07
R0137:Lamc3	UTSW	2	31908616	missense	probably damaging	1.00
R0179:Lamc3	UTSW	2	31915084	splice site	probably benign
R0244:Lamc3	UTSW	2	31940721	missense	probably damaging	1.00
R0512:Lamc3	UTSW	2	31937968	missense	probably damaging	1.00
R1052:Lamc3	UTSW	2	31928802	missense	probably benign	0.03
R1142:Lamc3	UTSW	2	31940721	missense	probably damaging	1.00
R1366:Lamc3	UTSW	2	31928847	missense	probably damaging	1.00
R1463:Lamc3	UTSW	2	31887411	missense	probably benign
R1515:Lamc3	UTSW	2	31940751	missense	probably damaging	1.00
R1642:Lamc3	UTSW	2	31915996	missense	probably damaging	1.00
R1692:Lamc3	UTSW	2	31921781	missense	probably null	0.01
R1707:Lamc3	UTSW	2	31912129	critical splice donor site	probably null
R1714:Lamc3	UTSW	2	31940757	missense	probably benign	0.02
R2940:Lamc3	UTSW	2	31940702	missense	probably benign	0.02
R3177:Lamc3	UTSW	2	31908625	missense	probably damaging	1.00
R3277:Lamc3	UTSW	2	31908625	missense	probably damaging	1.00
R3846:Lamc3	UTSW	2	31924592	missense	probably benign	0.01
R4065:Lamc3	UTSW	2	31945258	missense	probably benign	0.00
R4089:Lamc3	UTSW	2	31920508	nonsense	probably null
R4373:Lamc3	UTSW	2	31898232	missense	probably damaging	1.00
R4394:Lamc3	UTSW	2	31931952	missense	probably benign
R4395:Lamc3	UTSW	2	31931952	missense	probably benign
R4397:Lamc3	UTSW	2	31931952	missense	probably benign
R4746:Lamc3	UTSW	2	31905614	missense	possibly damaging	0.77
R4948:Lamc3	UTSW	2	31940736	missense	probably benign	0.02
R4960:Lamc3	UTSW	2	31915954	missense	probably benign	0.00
R5025:Lamc3	UTSW	2	31908669	missense	probably benign	0.13
R5062:Lamc3	UTSW	2	31905667	missense	possibly damaging	0.60
R5170:Lamc3	UTSW	2	31887344	start codon destroyed	probably benign	0.03
R5286:Lamc3	UTSW	2	31918596	missense	probably damaging	1.00
R5457:Lamc3	UTSW	2	31931985	missense	probably benign
R5655:Lamc3	UTSW	2	31925717	missense	probably benign	0.01
R5928:Lamc3	UTSW	2	31921709	missense	probably benign	0.00
R6018:Lamc3	UTSW	2	31905712	missense	probably damaging	1.00
R6479:Lamc3	UTSW	2	31887401	missense	probably benign
R6601:Lamc3	UTSW	2	31920532	missense	possibly damaging	0.94
R6920:Lamc3	UTSW	2	31908689	missense	probably damaging	1.00
R6924:Lamc3	UTSW	2	31938069	missense	probably benign
R7114:Lamc3	UTSW	2	31930645	missense	probably damaging	0.99
R7305:Lamc3	UTSW	2	31930702	missense	probably benign	0.39
R7559:Lamc3	UTSW	2	31922368	missense	probably benign	0.00
R7714:Lamc3	UTSW	2	31922267	splice site	probably null
R7787:Lamc3	UTSW	2	31900539	missense	probably damaging	0.99
R7819:Lamc3	UTSW	2	31921763	missense	probably benign
R8171:Lamc3	UTSW	2	31914971	missense	probably benign	0.06
R8208:Lamc3	UTSW	2	31887414	missense	possibly damaging	0.47
R8412:Lamc3	UTSW	2	31912116	missense	probably damaging	0.98
R9058:Lamc3	UTSW	2	31908641	missense	probably benign	0.01
R9242:Lamc3	UTSW	2	31898311	missense	probably benign	0.14
R9269:Lamc3	UTSW	2	31923005	missense	probably benign	0.11
R9269:Lamc3	UTSW	2	31928896	nonsense	probably null
X0010:Lamc3	UTSW	2	31938012	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTGGGGTACTGGAAGCAGAG -3'
(R):5'- AAAGACTCCTACACGGGCTC -3'

Sequencing Primer
(F):5'- CAGAGGGGCAAAGTAGCTCTG -3'
(R):5'- CTCCAGAGGAAGCAGGGTTTG -3'

Posted On

2014-06-23