Incidental Mutation 'R1838:Ralyl'
ID 205463
Institutional Source Beutler Lab
Gene Symbol Ralyl
Ensembl Gene ENSMUSG00000039717
Gene Name RALY RNA binding protein-like
Synonyms 0710005M24Rik
MMRRC Submission 039865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R1838 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 13536715-14247347 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14208472 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 204 (E204G)
Ref Sequence ENSEMBL: ENSMUSP00000104009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108372] [ENSMUST00000171075] [ENSMUST00000192209] [ENSMUST00000193117]
AlphaFold Q8BTF8
Predicted Effect probably damaging
Transcript: ENSMUST00000108372
AA Change: E204G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104009
Gene: ENSMUSG00000039717
AA Change: E204G

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
coiled coil region 119 182 N/A INTRINSIC
low complexity region 201 214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171075
SMART Domains Protein: ENSMUSP00000125848
Gene: ENSMUSG00000039717

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
coiled coil region 119 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192209
SMART Domains Protein: ENSMUSP00000142094
Gene: ENSMUSG00000039717

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
coiled coil region 119 156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193117
AA Change: E277G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,603,690 (GRCm39) D22G unknown Het
Abca4 G A 3: 121,921,954 (GRCm39) R1170K probably benign Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adamtsl3 G T 7: 82,142,581 (GRCm39) R267L probably damaging Het
Adgrb2 A T 4: 129,904,024 (GRCm39) T717S probably benign Het
Adgrb3 A G 1: 25,123,351 (GRCm39) S1417P probably damaging Het
Afg3l2 A T 18: 67,547,242 (GRCm39) V561D probably damaging Het
Atp13a2 T A 4: 140,721,643 (GRCm39) Y244* probably null Het
BB014433 C G 8: 15,092,629 (GRCm39) V75L unknown Het
Btnl6 T A 17: 34,734,516 (GRCm39) D82V probably damaging Het
Ccdc178 A G 18: 22,200,695 (GRCm39) Y421H probably damaging Het
Cdc123 A T 2: 5,799,702 (GRCm39) probably null Het
Cdhr5 C T 7: 140,852,516 (GRCm39) V367I possibly damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Ctnna2 T C 6: 77,822,525 (GRCm39) D26G probably damaging Het
Ctr9 G T 7: 110,651,510 (GRCm39) R910L possibly damaging Het
Cyp2t4 G T 7: 26,857,841 (GRCm39) R455L possibly damaging Het
Cyp3a13 A T 5: 137,909,894 (GRCm39) probably null Het
Dennd3 T C 15: 73,436,949 (GRCm39) S1059P probably damaging Het
Dennd4c A G 4: 86,743,415 (GRCm39) T1135A probably benign Het
Dnah7b T C 1: 46,155,337 (GRCm39) V295A probably benign Het
Dnah7b C A 1: 46,316,265 (GRCm39) T3126K probably damaging Het
Ehbp1l1 C T 19: 5,767,719 (GRCm39) E1195K probably benign Het
Exoc6b T A 6: 84,830,660 (GRCm39) I447L probably benign Het
Glt1d1 G A 5: 127,755,193 (GRCm39) V202I probably benign Het
Grk1 T C 8: 13,466,155 (GRCm39) V533A possibly damaging Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Gzma T A 13: 113,232,518 (GRCm39) I131F probably damaging Het
Helq A T 5: 100,919,745 (GRCm39) L35* probably null Het
Hnrnpll T C 17: 80,346,052 (GRCm39) N403S probably damaging Het
Hsf5 A G 11: 87,526,881 (GRCm39) K518E probably benign Het
Ighe T A 12: 113,235,470 (GRCm39) H258L unknown Het
Il6ra T C 3: 89,797,579 (GRCm39) D96G probably benign Het
Ints13 C T 6: 146,468,109 (GRCm39) A129T possibly damaging Het
Ipo7 T A 7: 109,641,316 (GRCm39) H345Q probably damaging Het
Kcna2 A T 3: 107,011,828 (GRCm39) E136D probably benign Het
Kif5a G A 10: 127,072,684 (GRCm39) Q702* probably null Het
Klhdc7a G T 4: 139,694,381 (GRCm39) P189T probably benign Het
Krtap4-9 A G 11: 99,676,222 (GRCm39) probably benign Het
Lamc3 T C 2: 31,815,594 (GRCm39) S1097P possibly damaging Het
Ldlrad2 A T 4: 137,299,481 (GRCm39) N114K probably benign Het
Lrfn1 A T 7: 28,159,193 (GRCm39) I371L probably damaging Het
Lrwd1 A G 5: 136,161,242 (GRCm39) V240A probably benign Het
Lypd1 A T 1: 125,801,108 (GRCm39) probably benign Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Man2c1 A G 9: 57,044,621 (GRCm39) N354S probably benign Het
Map3k13 T C 16: 21,732,939 (GRCm39) Y514H possibly damaging Het
Med15 T C 16: 17,471,426 (GRCm39) D577G probably benign Het
Mroh4 A T 15: 74,487,962 (GRCm39) M320K probably benign Het
Ms4a10 T A 19: 10,941,411 (GRCm39) D186V possibly damaging Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Myo5c A T 9: 75,180,835 (GRCm39) R741S probably damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Naip6 T C 13: 100,452,644 (GRCm39) D139G probably damaging Het
Or10s1 A T 9: 39,985,605 (GRCm39) M5L probably benign Het
Or2p2 A T 13: 21,256,595 (GRCm39) L292* probably null Het
Or4a79 A T 2: 89,552,053 (GRCm39) M134K probably damaging Het
Or8g2 A T 9: 39,821,137 (GRCm39) I13F possibly damaging Het
Pcdhb3 A G 18: 37,434,370 (GRCm39) D112G probably benign Het
Pdpr C A 8: 111,861,366 (GRCm39) P787T probably damaging Het
Pgm3 C T 9: 86,451,286 (GRCm39) V123I probably benign Het
Pms1 A C 1: 53,231,257 (GRCm39) probably null Het
Prl2b1 A G 13: 27,572,549 (GRCm39) S14P possibly damaging Het
Prune2 T A 19: 17,177,242 (GRCm39) W212R probably damaging Het
Rabgef1 A G 5: 130,241,862 (GRCm39) E422G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,558,962 (GRCm39) probably benign Het
Rit1 C G 3: 88,636,477 (GRCm39) T127S probably damaging Het
Slc16a7 C T 10: 125,067,067 (GRCm39) V191M probably damaging Het
Slc34a2 A T 5: 53,215,778 (GRCm39) H63L probably benign Het
Smpd4 G A 16: 17,460,166 (GRCm39) probably null Het
Sp3 A G 2: 72,768,520 (GRCm39) S748P possibly damaging Het
Spata31d1b G A 13: 59,863,671 (GRCm39) C273Y probably benign Het
Spata31d1b G A 13: 59,865,279 (GRCm39) R809K probably benign Het
Tmco5 A T 2: 116,711,360 (GRCm39) E90V probably damaging Het
Tnxb A T 17: 34,897,884 (GRCm39) D844V probably damaging Het
Tpi1 T C 6: 124,791,115 (GRCm39) T41A probably benign Het
Ttn T C 2: 76,557,536 (GRCm39) I29853V probably damaging Het
Vmn2r26 C T 6: 124,001,730 (GRCm39) T5I probably benign Het
Wdr95 A G 5: 149,522,831 (GRCm39) D663G probably benign Het
Zbtb39 T C 10: 127,578,569 (GRCm39) F381S probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp646 T A 7: 127,478,911 (GRCm39) Y363N probably damaging Het
Zfp712 A C 13: 67,190,111 (GRCm39) C139G probably damaging Het
Zfp958 A G 8: 4,678,590 (GRCm39) H205R probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Ralyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Ralyl APN 3 14,172,332 (GRCm39) splice site probably benign
IGL02626:Ralyl APN 3 13,842,094 (GRCm39) missense probably benign 0.00
IGL02950:Ralyl APN 3 14,104,781 (GRCm39) missense probably damaging 1.00
PIT4498001:Ralyl UTSW 3 14,172,299 (GRCm39) missense probably damaging 0.99
R0853:Ralyl UTSW 3 14,011,566 (GRCm39) missense probably damaging 1.00
R1061:Ralyl UTSW 3 14,180,761 (GRCm39) missense probably damaging 1.00
R1068:Ralyl UTSW 3 13,841,949 (GRCm39) missense probably damaging 1.00
R1655:Ralyl UTSW 3 14,172,296 (GRCm39) missense probably damaging 1.00
R1796:Ralyl UTSW 3 14,208,493 (GRCm39) missense possibly damaging 0.77
R4706:Ralyl UTSW 3 14,104,850 (GRCm39) critical splice donor site probably null
R5505:Ralyl UTSW 3 13,841,980 (GRCm39) missense probably damaging 1.00
R5510:Ralyl UTSW 3 13,842,005 (GRCm39) missense probably damaging 1.00
R6844:Ralyl UTSW 3 13,841,938 (GRCm39) missense probably damaging 1.00
R6919:Ralyl UTSW 3 13,842,091 (GRCm39) missense probably damaging 1.00
R7876:Ralyl UTSW 3 14,104,850 (GRCm39) critical splice donor site probably null
R8297:Ralyl UTSW 3 14,104,836 (GRCm39) missense probably benign 0.33
R9292:Ralyl UTSW 3 14,172,312 (GRCm39) missense probably benign 0.06
R9686:Ralyl UTSW 3 13,841,887 (GRCm39) splice site probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCTCACCCCTTTTAAAAGTTC -3'
(R):5'- TGTTCCCTCAAACATATTGACACAG -3'

Sequencing Primer
(F):5'- CTTACTAGCAAGCCAAGGTAGTAGTC -3'
(R):5'- CTATTGCTGTCACCCAAC -3'
Posted On 2014-06-23