Incidental Mutation 'R1838:Kcna2'
Institutional Source Beutler Lab
Gene Symbol Kcna2
Ensembl Gene ENSMUSG00000040724
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 2
SynonymsMk-2, Akr6a4, Kca1-2, Kv1.2
MMRRC Submission 039865-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1838 (G1)
Quality Score225
Status Not validated
Chromosomal Location107101146-107115005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107104512 bp
Amino Acid Change Glutamic Acid to Aspartic acid at position 136 (E136D)
Ref Sequence ENSEMBL: ENSMUSP00000143798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038695] [ENSMUST00000196403] [ENSMUST00000197470]
Predicted Effect probably benign
Transcript: ENSMUST00000038695
AA Change: E136D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041702
Gene: ENSMUSG00000040724
AA Change: E136D

BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196403
AA Change: E136D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142873
Gene: ENSMUSG00000040724
AA Change: E136D

BTB 33 133 1.2e-9 SMART
low complexity region 164 179 N/A INTRINSIC
Pfam:Ion_trans 224 409 1.3e-36 PFAM
Pfam:Ion_trans_2 329 414 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197470
AA Change: E136D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143798
Gene: ENSMUSG00000040724
AA Change: E136D

BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, increased susceptibility to spontaneous and chemically-induced seizures and altered neuron electrophysiology. Mice homozygous for an ENU-induced allele exhibit abnormal gait, impaired coordination, and premature lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,727 D22G unknown Het
Abca4 G A 3: 122,128,305 R1170K probably benign Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adamtsl3 G T 7: 82,493,373 R267L probably damaging Het
Adgrb2 A T 4: 130,010,231 T717S probably benign Het
Adgrb3 A G 1: 25,084,270 S1417P probably damaging Het
Afg3l2 A T 18: 67,414,172 V561D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Btnl6 T A 17: 34,515,542 D82V probably damaging Het
Ccdc178 A G 18: 22,067,638 Y421H probably damaging Het
Cdc123 A T 2: 5,794,891 probably null Het
Cdhr5 C T 7: 141,272,603 V367I possibly damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Ctnna2 T C 6: 77,845,542 D26G probably damaging Het
Ctr9 G T 7: 111,052,303 R910L possibly damaging Het
Cyp2t4 G T 7: 27,158,416 R455L possibly damaging Het
Cyp3a13 A T 5: 137,911,632 probably null Het
Dennd3 T C 15: 73,565,100 S1059P probably damaging Het
Dennd4c A G 4: 86,825,178 T1135A probably benign Het
Dnah7b T C 1: 46,116,177 V295A probably benign Het
Dnah7b C A 1: 46,277,105 T3126K probably damaging Het
Ehbp1l1 C T 19: 5,717,691 E1195K probably benign Het
Exoc6b T A 6: 84,853,678 I447L probably benign Het
Glt1d1 G A 5: 127,678,129 V202I probably benign Het
Grk1 T C 8: 13,416,155 V533A possibly damaging Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Gzma T A 13: 113,095,984 I131F probably damaging Het
Helq A T 5: 100,771,879 L35* probably null Het
Hnrnpll T C 17: 80,038,623 N403S probably damaging Het
Hsf5 A G 11: 87,636,055 K518E probably benign Het
Ighe T A 12: 113,271,850 H258L unknown Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Ints13 C T 6: 146,566,611 A129T possibly damaging Het
Ipo7 T A 7: 110,042,109 H345Q probably damaging Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krtap4-9 A G 11: 99,785,396 probably benign Het
Lamc3 T C 2: 31,925,582 S1097P possibly damaging Het
Ldlrad2 A T 4: 137,572,170 N114K probably benign Het
Lrfn1 A T 7: 28,459,768 I371L probably damaging Het
Lrwd1 A G 5: 136,132,388 V240A probably benign Het
Lypd1 A T 1: 125,873,371 probably benign Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Man2c1 A G 9: 57,137,337 N354S probably benign Het
Map3k13 T C 16: 21,914,189 Y514H possibly damaging Het
Med15 T C 16: 17,653,562 D577G probably benign Het
Mroh4 A T 15: 74,616,113 M320K probably benign Het
Ms4a10 T A 19: 10,964,047 D186V possibly damaging Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Myo5c A T 9: 75,273,553 R741S probably damaging Het
Naip6 T C 13: 100,316,136 D139G probably damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Olfr1252 A T 2: 89,721,709 M134K probably damaging Het
Olfr1370 A T 13: 21,072,425 L292* probably null Het
Olfr229 A T 9: 39,909,841 I13F possibly damaging Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Pcdhb3 A G 18: 37,301,317 D112G probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Pgm3 C T 9: 86,569,233 V123I probably benign Het
Pms1 A C 1: 53,192,098 probably null Het
Prl2b1 A G 13: 27,388,566 S14P possibly damaging Het
Prune2 T A 19: 17,199,878 W212R probably damaging Het
Rabgef1 A G 5: 130,213,021 E422G probably benign Het
Ralyl A G 3: 14,143,412 E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,651,680 probably benign Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Slc16a7 C T 10: 125,231,198 V191M probably damaging Het
Slc34a2 A T 5: 53,058,436 H63L probably benign Het
Smpd4 G A 16: 17,642,302 probably null Het
Sp3 A G 2: 72,938,176 S748P possibly damaging Het
Spata31d1b G A 13: 59,715,857 C273Y probably benign Het
Spata31d1b G A 13: 59,717,465 R809K probably benign Het
Tmco5 A T 2: 116,880,879 E90V probably damaging Het
Tnxb A T 17: 34,678,910 D844V probably damaging Het
Tpi1 T C 6: 124,814,152 T41A probably benign Het
Ttn T C 2: 76,727,192 I29853V probably damaging Het
Vmn2r26 C T 6: 124,024,771 T5I probably benign Het
Wdr95 A G 5: 149,599,366 D663G probably benign Het
Zbtb39 T C 10: 127,742,700 F381S probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp646 T A 7: 127,879,739 Y363N probably damaging Het
Zfp712 A C 13: 67,042,047 C139G probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Kcna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcna2 APN 3 107104630 missense probably damaging 1.00
IGL00711:Kcna2 APN 3 107104753 missense probably benign
IGL02380:Kcna2 APN 3 107104958 missense probably benign 0.00
grim UTSW 3 107105027 missense probably damaging 1.00
IGL03097:Kcna2 UTSW 3 107105399 missense probably benign 0.02
R0117:Kcna2 UTSW 3 107105354 missense probably damaging 1.00
R0200:Kcna2 UTSW 3 107105160 missense probably benign
R0463:Kcna2 UTSW 3 107105160 missense probably benign
R0472:Kcna2 UTSW 3 107105516 missense probably benign
R0662:Kcna2 UTSW 3 107105401 missense probably benign
R0746:Kcna2 UTSW 3 107105168 missense probably benign
R1847:Kcna2 UTSW 3 107105113 missense possibly damaging 0.54
R1912:Kcna2 UTSW 3 107105401 missense probably benign
R1966:Kcna2 UTSW 3 107104630 missense probably damaging 1.00
R1971:Kcna2 UTSW 3 107104824 missense probably damaging 1.00
R2419:Kcna2 UTSW 3 107104153 missense probably benign 0.21
R3796:Kcna2 UTSW 3 107105590 missense probably benign 0.37
R3830:Kcna2 UTSW 3 107104796 missense probably benign 0.04
R4273:Kcna2 UTSW 3 107105193 missense probably benign 0.00
R4570:Kcna2 UTSW 3 107104795 missense probably benign
R4662:Kcna2 UTSW 3 107105417 missense probably benign
R4756:Kcna2 UTSW 3 107105417 missense probably benign
R5054:Kcna2 UTSW 3 107104340 missense probably damaging 1.00
R5069:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5070:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5126:Kcna2 UTSW 3 107104234 missense probably damaging 1.00
R5146:Kcna2 UTSW 3 107105498 missense probably benign 0.00
R5205:Kcna2 UTSW 3 107097146 unclassified probably benign
R5472:Kcna2 UTSW 3 107105309 missense possibly damaging 0.93
R6687:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R6689:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R7216:Kcna2 UTSW 3 107104793 missense probably damaging 0.99
R7304:Kcna2 UTSW 3 107104750 missense probably benign
R7538:Kcna2 UTSW 3 107104568 missense probably benign 0.31
R7585:Kcna2 UTSW 3 107105342 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-06-23