Incidental Mutation 'R1838:Vmn2r26'
ID 205488
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 039865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R1838 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 124024771 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 5 (T5I)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: T5I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: T5I

signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,727 D22G unknown Het
Abca4 G A 3: 122,128,305 R1170K probably benign Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adamtsl3 G T 7: 82,493,373 R267L probably damaging Het
Adgrb2 A T 4: 130,010,231 T717S probably benign Het
Adgrb3 A G 1: 25,084,270 S1417P probably damaging Het
Afg3l2 A T 18: 67,414,172 V561D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Btnl6 T A 17: 34,515,542 D82V probably damaging Het
Ccdc178 A G 18: 22,067,638 Y421H probably damaging Het
Cdc123 A T 2: 5,794,891 probably null Het
Cdhr5 C T 7: 141,272,603 V367I possibly damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Ctnna2 T C 6: 77,845,542 D26G probably damaging Het
Ctr9 G T 7: 111,052,303 R910L possibly damaging Het
Cyp2t4 G T 7: 27,158,416 R455L possibly damaging Het
Cyp3a13 A T 5: 137,911,632 probably null Het
Dennd3 T C 15: 73,565,100 S1059P probably damaging Het
Dennd4c A G 4: 86,825,178 T1135A probably benign Het
Dnah7b T C 1: 46,116,177 V295A probably benign Het
Dnah7b C A 1: 46,277,105 T3126K probably damaging Het
Ehbp1l1 C T 19: 5,717,691 E1195K probably benign Het
Exoc6b T A 6: 84,853,678 I447L probably benign Het
Glt1d1 G A 5: 127,678,129 V202I probably benign Het
Grk1 T C 8: 13,416,155 V533A possibly damaging Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Gzma T A 13: 113,095,984 I131F probably damaging Het
Helq A T 5: 100,771,879 L35* probably null Het
Hnrnpll T C 17: 80,038,623 N403S probably damaging Het
Hsf5 A G 11: 87,636,055 K518E probably benign Het
Ighe T A 12: 113,271,850 H258L unknown Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Ints13 C T 6: 146,566,611 A129T possibly damaging Het
Ipo7 T A 7: 110,042,109 H345Q probably damaging Het
Kcna2 A T 3: 107,104,512 E136D probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krtap4-9 A G 11: 99,785,396 probably benign Het
Lamc3 T C 2: 31,925,582 S1097P possibly damaging Het
Ldlrad2 A T 4: 137,572,170 N114K probably benign Het
Lrfn1 A T 7: 28,459,768 I371L probably damaging Het
Lrwd1 A G 5: 136,132,388 V240A probably benign Het
Lypd1 A T 1: 125,873,371 probably benign Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Man2c1 A G 9: 57,137,337 N354S probably benign Het
Map3k13 T C 16: 21,914,189 Y514H possibly damaging Het
Med15 T C 16: 17,653,562 D577G probably benign Het
Mroh4 A T 15: 74,616,113 M320K probably benign Het
Ms4a10 T A 19: 10,964,047 D186V possibly damaging Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Myo5c A T 9: 75,273,553 R741S probably damaging Het
Naip6 T C 13: 100,316,136 D139G probably damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Olfr1252 A T 2: 89,721,709 M134K probably damaging Het
Olfr1370 A T 13: 21,072,425 L292* probably null Het
Olfr229 A T 9: 39,909,841 I13F possibly damaging Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Pcdhb3 A G 18: 37,301,317 D112G probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Pgm3 C T 9: 86,569,233 V123I probably benign Het
Pms1 A C 1: 53,192,098 probably null Het
Prl2b1 A G 13: 27,388,566 S14P possibly damaging Het
Prune2 T A 19: 17,199,878 W212R probably damaging Het
Rabgef1 A G 5: 130,213,021 E422G probably benign Het
Ralyl A G 3: 14,143,412 E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,651,680 probably benign Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Slc16a7 C T 10: 125,231,198 V191M probably damaging Het
Slc34a2 A T 5: 53,058,436 H63L probably benign Het
Smpd4 G A 16: 17,642,302 probably null Het
Sp3 A G 2: 72,938,176 S748P possibly damaging Het
Spata31d1b G A 13: 59,715,857 C273Y probably benign Het
Spata31d1b G A 13: 59,717,465 R809K probably benign Het
Tmco5 A T 2: 116,880,879 E90V probably damaging Het
Tnxb A T 17: 34,678,910 D844V probably damaging Het
Tpi1 T C 6: 124,814,152 T41A probably benign Het
Ttn T C 2: 76,727,192 I29853V probably damaging Het
Wdr95 A G 5: 149,599,366 D663G probably benign Het
Zbtb39 T C 10: 127,742,700 F381S probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp646 T A 7: 127,879,739 Y363N probably damaging Het
Zfp712 A C 13: 67,042,047 C139G probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-06-23