Incidental Mutation 'R0112:Ripk4'
ID20550
Institutional Source Beutler Lab
Gene Symbol Ripk4
Ensembl Gene ENSMUSG00000005251
Gene Namereceptor-interacting serine-threonine kinase 4
SynonymsAnkrd3, DIk, PKK, ANKK2, RIP4
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R0112 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location97741933-97763787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97743561 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 629 (C629R)
Ref Sequence ENSEMBL: ENSMUSP00000019386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019386] [ENSMUST00000113743]
Predicted Effect probably benign
Transcript: ENSMUST00000019386
AA Change: C629R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019386
Gene: ENSMUSG00000005251
AA Change: C629R

DomainStartEndE-ValueType
Pfam:Pkinase 22 283 1.8e-47 PFAM
Pfam:Pkinase_Tyr 23 283 6e-45 PFAM
low complexity region 356 396 N/A INTRINSIC
ANK 439 468 2.58e-3 SMART
ANK 472 501 3.41e-3 SMART
ANK 505 534 7.42e-4 SMART
ANK 538 567 3.57e-6 SMART
ANK 571 601 3.85e-2 SMART
ANK 605 634 3.15e-7 SMART
ANK 638 667 5.16e-3 SMART
ANK 671 700 2.2e-6 SMART
ANK 704 734 1.68e-2 SMART
ANK 736 765 3.46e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113743
AA Change: C566R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109372
Gene: ENSMUSG00000005251
AA Change: C566R

DomainStartEndE-ValueType
Pfam:Pkinase 1 220 1e-39 PFAM
Pfam:Pkinase_Tyr 1 220 7.4e-39 PFAM
low complexity region 293 333 N/A INTRINSIC
ANK 376 405 2.58e-3 SMART
ANK 409 438 3.41e-3 SMART
ANK 442 471 7.42e-4 SMART
ANK 475 504 3.57e-6 SMART
ANK 508 538 3.85e-2 SMART
ANK 542 571 3.15e-7 SMART
ANK 575 604 5.16e-3 SMART
ANK 608 637 2.2e-6 SMART
ANK 641 671 1.68e-2 SMART
ANK 673 702 3.46e-4 SMART
Meta Mutation Damage Score 0.1655 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that interacts with protein kinase C-delta. The encoded protein can also activate NFkappaB and is required for keratinocyte differentiation. This kinase undergoes autophosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in perinatal lethality and epithelial developmental defects. Homozygous mutant lack oral, anal, and nasal openings and display shorter hindlimbs and tail that are partially fused to the body. The skin is significantly thicker with areas of orthokeratosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Afdn T C 17: 13,884,637 S1186P probably damaging Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fes T C 7: 80,384,005 D166G probably damaging Het
Fn1 A G 1: 71,609,653 S1366P probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Gp6 C A 7: 4,370,184 A247S probably benign Het
Gp6 G C 7: 4,371,627 P232A probably benign Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lmo7 A T 14: 101,887,193 R363* probably null Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1383 A T 11: 49,524,134 H137L possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Parg C A 14: 32,202,433 A63E probably damaging Het
Pik3cg A G 12: 32,195,715 probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slc19a1 T C 10: 77,042,165 I178T probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Tmem131l G A 3: 83,940,587 Q324* probably null Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Ripk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ripk4 APN 16 97751496 nonsense probably null
IGL01823:Ripk4 APN 16 97755283 missense possibly damaging 0.89
IGL01921:Ripk4 APN 16 97743365 missense possibly damaging 0.62
IGL02023:Ripk4 APN 16 97755231 missense probably damaging 1.00
IGL02201:Ripk4 APN 16 97755177 missense possibly damaging 0.91
IGL02709:Ripk4 APN 16 97743566 missense probably damaging 1.00
I2288:Ripk4 UTSW 16 97748145 missense probably benign 0.16
PIT4495001:Ripk4 UTSW 16 97743170 missense probably damaging 0.99
R0060:Ripk4 UTSW 16 97763518 splice site probably benign
R0383:Ripk4 UTSW 16 97748112 missense probably damaging 1.00
R0524:Ripk4 UTSW 16 97755287 nonsense probably null
R0540:Ripk4 UTSW 16 97744175 missense probably damaging 1.00
R0967:Ripk4 UTSW 16 97744172 missense probably damaging 1.00
R1646:Ripk4 UTSW 16 97743897 missense probably damaging 1.00
R1785:Ripk4 UTSW 16 97750131 missense probably damaging 1.00
R2058:Ripk4 UTSW 16 97744142 nonsense probably null
R2134:Ripk4 UTSW 16 97743733 missense probably damaging 1.00
R2135:Ripk4 UTSW 16 97743733 missense probably damaging 1.00
R3410:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R3411:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R4538:Ripk4 UTSW 16 97743152 nonsense probably null
R4627:Ripk4 UTSW 16 97744026 missense probably damaging 0.99
R4665:Ripk4 UTSW 16 97755073 missense probably damaging 0.98
R4704:Ripk4 UTSW 16 97746004 nonsense probably null
R4769:Ripk4 UTSW 16 97744062 missense probably damaging 1.00
R4860:Ripk4 UTSW 16 97751536 missense probably damaging 0.97
R4860:Ripk4 UTSW 16 97751536 missense probably damaging 0.97
R5240:Ripk4 UTSW 16 97743767 missense probably damaging 1.00
R5864:Ripk4 UTSW 16 97763582 missense probably damaging 0.98
R6027:Ripk4 UTSW 16 97744074 missense probably damaging 1.00
R6035:Ripk4 UTSW 16 97744187 missense probably damaging 1.00
R6035:Ripk4 UTSW 16 97744187 missense probably damaging 1.00
R6291:Ripk4 UTSW 16 97755123 missense probably damaging 1.00
R6343:Ripk4 UTSW 16 97763526 critical splice donor site probably benign
R6572:Ripk4 UTSW 16 97745905 nonsense probably null
R6783:Ripk4 UTSW 16 97748037 missense probably damaging 1.00
R6822:Ripk4 UTSW 16 97746036 missense probably damaging 1.00
R7215:Ripk4 UTSW 16 97747323 splice site probably null
R7251:Ripk4 UTSW 16 97743249 missense probably benign
R7275:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R7356:Ripk4 UTSW 16 97743149 missense probably damaging 0.98
R7621:Ripk4 UTSW 16 97745925 missense probably damaging 1.00
R8065:Ripk4 UTSW 16 97763537 missense probably damaging 0.97
R8067:Ripk4 UTSW 16 97763537 missense probably damaging 0.97
R8191:Ripk4 UTSW 16 97763526 critical splice donor site probably benign
Z1176:Ripk4 UTSW 16 97750102 missense probably damaging 1.00
Z1177:Ripk4 UTSW 16 97755178 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGACAGGTCAATGAGGTCAGCAC -3'
(R):5'- ATGCCTGGTTGCCTCTGCACTATG -3'

Sequencing Primer
(F):5'- CCTCTATGAGCAGCTTGACAGTAG -3'
(R):5'- TGCACTATGCTGCCTGG -3'
Posted On2013-04-11