Mutagenetix > Incidental Mutations

Incidental Mutation 'R0112:Ripk4'

20550

Institutional Source

Beutler Lab

Gene Symbol

Ripk4

Ensembl Gene

ENSMUSG00000005251

Gene Name

receptor-interacting serine-threonine kinase 4

Synonyms

Ankrd3, DIk, PKK, ANKK2, RIP4

MMRRC Submission

038398-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.325) question?

Stock #

R0112 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

97741933-97763787 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97743561 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 629 (C629R)

Ref Sequence

ENSEMBL: ENSMUSP00000019386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019386] [ENSMUST00000113743]

Predicted Effect

probably benign
Transcript: ENSMUST00000019386
AA Change: C629R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000019386
Gene: ENSMUSG00000005251
AA Change: C629R

Domain	Start	End	E-Value	Type
Pfam:Pkinase	22	283	1.8e-47	PFAM
Pfam:Pkinase_Tyr	23	283	6e-45	PFAM
low complexity region	356	396	N/A	INTRINSIC
ANK	439	468	2.58e-3	SMART
ANK	472	501	3.41e-3	SMART
ANK	505	534	7.42e-4	SMART
ANK	538	567	3.57e-6	SMART
ANK	571	601	3.85e-2	SMART
ANK	605	634	3.15e-7	SMART
ANK	638	667	5.16e-3	SMART
ANK	671	700	2.2e-6	SMART
ANK	704	734	1.68e-2	SMART
ANK	736	765	3.46e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113743
AA Change: C566R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000109372
Gene: ENSMUSG00000005251
AA Change: C566R

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	220	1e-39	PFAM
Pfam:Pkinase_Tyr	1	220	7.4e-39	PFAM
low complexity region	293	333	N/A	INTRINSIC
ANK	376	405	2.58e-3	SMART
ANK	409	438	3.41e-3	SMART
ANK	442	471	7.42e-4	SMART
ANK	475	504	3.57e-6	SMART
ANK	508	538	3.85e-2	SMART
ANK	542	571	3.15e-7	SMART
ANK	575	604	5.16e-3	SMART
ANK	608	637	2.2e-6	SMART
ANK	641	671	1.68e-2	SMART
ANK	673	702	3.46e-4	SMART

Meta Mutation Damage Score

0.1655

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 96.0%
20x: 91.8%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that interacts with protein kinase C-delta. The encoded protein can also activate NFkappaB and is required for keratinocyte differentiation. This kinase undergoes autophosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in perinatal lethality and epithelial developmental defects. Homozygous mutant lack oral, anal, and nasal openings and display shorter hindlimbs and tail that are partially fused to the body. The skin is significantly thicker with areas of orthokeratosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	A	2: 35,354,803	Y179F	probably benign	Het
Abcd4	A	G	12: 84,612,899		probably benign	Het
Abhd12b	C	T	12: 70,181,017	T191M	probably benign	Het
Adcy5	A	G	16: 35,156,178	E27G	possibly damaging	Het
Adgb	G	A	10: 10,407,158		probably benign	Het
Afdn	T	C	17: 13,884,637	S1186P	probably damaging	Het
Atf6b	G	T	17: 34,651,626	R351L	probably damaging	Het
Axin2	T	C	11: 108,939,397	S348P	possibly damaging	Het
BC030499	T	C	11: 78,291,681		probably benign	Het
Bfsp1	A	C	2: 143,827,643		probably null	Het
Brd1	A	G	15: 88,730,383	V103A	probably benign	Het
Ccdc13	C	A	9: 121,813,481	K392N	probably damaging	Het
Ccdc18	A	G	5: 108,173,761	K577R	probably damaging	Het
Csmd2	G	T	4: 128,496,029	G2186C	probably damaging	Het
Cyp2j5	A	T	4: 96,629,523	M484K	probably benign	Het
Defb3	T	A	8: 19,293,407	L12Q	probably null	Het
Defb7	G	T	8: 19,495,170		probably null	Het
Dhx35	T	A	2: 158,840,620	M491K	probably damaging	Het
Dnah17	T	C	11: 118,074,434	S2261G	possibly damaging	Het
Dnah5	A	C	15: 28,263,679	E853D	probably benign	Het
Dner	C	A	1: 84,583,053	A23S	probably benign	Het
Dock5	A	C	14: 67,819,641	S539A	probably benign	Het
Dsg2	T	A	18: 20,583,042	F317I	probably benign	Het
Enox1	A	T	14: 77,699,198	I539F	possibly damaging	Het
Eogt	G	A	6: 97,135,284		probably benign	Het
Fbxo22	A	G	9: 55,223,346	T300A	probably benign	Het
Fes	T	C	7: 80,384,005	D166G	probably damaging	Het
Fn1	A	G	1: 71,609,653	S1366P	probably damaging	Het
Fndc3a	A	T	14: 72,540,495		probably benign	Het
Foxh1	T	C	15: 76,669,010	H168R	probably benign	Het
Galnt14	T	G	17: 73,574,984		probably benign	Het
Gdf6	A	G	4: 9,844,482	D2G	probably damaging	Het
Gp6	C	A	7: 4,370,184	A247S	probably benign	Het
Gp6	G	C	7: 4,371,627	P232A	probably benign	Het
Grin2c	A	G	11: 115,251,134	Y820H	probably damaging	Het
Gtf2h4	T	C	17: 35,670,448	T198A	possibly damaging	Het
Helz	T	C	11: 107,672,948		probably benign	Het
Htr1d	A	G	4: 136,443,000	E180G	probably benign	Het
Igsf10	A	G	3: 59,326,008	V1768A	probably benign	Het
Ints10	A	T	8: 68,827,302	T694S	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lipc	T	A	9: 70,820,427	Y131F	probably damaging	Het
Litaf	G	T	16: 10,966,511	T45K	probably damaging	Het
Lmo7	A	T	14: 101,887,193	R363*	probably null	Het
Lrrc37a	A	T	11: 103,500,913	Y1229N	probably benign	Het
Man2a2	C	T	7: 80,358,276	A943T	probably damaging	Het
Mtor	A	G	4: 148,480,923	Y1030C	probably damaging	Het
Naalad2	G	T	9: 18,351,447	Y384*	probably null	Het
Nat2	C	T	8: 67,501,726	Q163*	probably null	Het
Nell2	A	G	15: 95,431,681		probably benign	Het
Nphp3	C	T	9: 104,037,348	H102Y	possibly damaging	Het
Olfr1383	A	T	11: 49,524,134	H137L	possibly damaging	Het
Olfr1442	C	T	19: 12,674,757	T184I	probably benign	Het
Olfr686	A	T	7: 105,203,659	M228K	probably benign	Het
Olr1	T	C	6: 129,488,906	S46G	possibly damaging	Het
Parg	C	A	14: 32,202,433	A63E	probably damaging	Het
Pik3cg	A	G	12: 32,195,715		probably benign	Het
Rnf145	A	G	11: 44,564,151	T620A	probably benign	Het
Samd9l	T	G	6: 3,376,031	D410A	possibly damaging	Het
Serpinb9f	A	T	13: 33,327,951		probably benign	Het
Slc19a1	T	C	10: 77,042,165	I178T	probably benign	Het
Slco1b2	A	T	6: 141,671,111	Y390F	probably benign	Het
Speg	A	G	1: 75,385,032	E230G	possibly damaging	Het
Tbc1d9	C	A	8: 83,264,837		probably benign	Het
Tmem131l	G	A	3: 83,940,587	Q324*	probably null	Het
Trf	A	G	9: 103,226,956		probably benign	Het
Trp53	T	G	11: 69,588,679	Y202D	probably damaging	Het
Trpv1	T	A	11: 73,253,272	M618K	probably damaging	Het
Trrap	C	A	5: 144,822,761	Y2250*	probably null	Het
Ttc3	A	G	16: 94,385,322		probably benign	Het
Ubtfl1	T	G	9: 18,409,787	S204A	probably benign	Het
Uck2	A	T	1: 167,227,771	Y203N	probably damaging	Het
Utrn	A	T	10: 12,686,465	L1280*	probably null	Het
Vmn1r178	A	T	7: 23,894,184	H146L	possibly damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r108	T	C	17: 20,471,635	M209V	probably benign	Het
Vmn2r9	G	A	5: 108,843,125	T790I	probably damaging	Het
Vmn2r94	C	A	17: 18,243,604	R808L	probably benign	Het
Zbtb7c	A	T	18: 76,136,891	S17C	probably damaging	Het
Zfp811	C	T	17: 32,797,764	R434Q	probably damaging	Het
Zkscan6	A	T	11: 65,814,863		probably benign	Het

Other mutations in Ripk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01548:Ripk4	APN	16	97751496	nonsense	probably null
IGL01823:Ripk4	APN	16	97755283	missense	possibly damaging	0.89
IGL01921:Ripk4	APN	16	97743365	missense	possibly damaging	0.62
IGL02023:Ripk4	APN	16	97755231	missense	probably damaging	1.00
IGL02201:Ripk4	APN	16	97755177	missense	possibly damaging	0.91
IGL02709:Ripk4	APN	16	97743566	missense	probably damaging	1.00
I2288:Ripk4	UTSW	16	97748145	missense	probably benign	0.16
PIT4495001:Ripk4	UTSW	16	97743170	missense	probably damaging	0.99
R0060:Ripk4	UTSW	16	97763518	splice site	probably benign
R0383:Ripk4	UTSW	16	97748112	missense	probably damaging	1.00
R0524:Ripk4	UTSW	16	97755287	nonsense	probably null
R0540:Ripk4	UTSW	16	97744175	missense	probably damaging	1.00
R0967:Ripk4	UTSW	16	97744172	missense	probably damaging	1.00
R1646:Ripk4	UTSW	16	97743897	missense	probably damaging	1.00
R1785:Ripk4	UTSW	16	97750131	missense	probably damaging	1.00
R2058:Ripk4	UTSW	16	97744142	nonsense	probably null
R2134:Ripk4	UTSW	16	97743733	missense	probably damaging	1.00
R2135:Ripk4	UTSW	16	97743733	missense	probably damaging	1.00
R3410:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R3411:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R4538:Ripk4	UTSW	16	97743152	nonsense	probably null
R4627:Ripk4	UTSW	16	97744026	missense	probably damaging	0.99
R4665:Ripk4	UTSW	16	97755073	missense	probably damaging	0.98
R4704:Ripk4	UTSW	16	97746004	nonsense	probably null
R4769:Ripk4	UTSW	16	97744062	missense	probably damaging	1.00
R4860:Ripk4	UTSW	16	97751536	missense	probably damaging	0.97
R4860:Ripk4	UTSW	16	97751536	missense	probably damaging	0.97
R5240:Ripk4	UTSW	16	97743767	missense	probably damaging	1.00
R5864:Ripk4	UTSW	16	97763582	missense	probably damaging	0.98
R6027:Ripk4	UTSW	16	97744074	missense	probably damaging	1.00
R6035:Ripk4	UTSW	16	97744187	missense	probably damaging	1.00
R6035:Ripk4	UTSW	16	97744187	missense	probably damaging	1.00
R6291:Ripk4	UTSW	16	97755123	missense	probably damaging	1.00
R6343:Ripk4	UTSW	16	97763526	critical splice donor site	probably benign
R6572:Ripk4	UTSW	16	97745905	nonsense	probably null
R6783:Ripk4	UTSW	16	97748037	missense	probably damaging	1.00
R6822:Ripk4	UTSW	16	97746036	missense	probably damaging	1.00
R7215:Ripk4	UTSW	16	97747323	splice site	probably null
R7251:Ripk4	UTSW	16	97743249	missense	probably benign
R7275:Ripk4	UTSW	16	97743957	missense	probably benign	0.00
R7356:Ripk4	UTSW	16	97743149	missense	probably damaging	0.98
R7621:Ripk4	UTSW	16	97745925	missense	probably damaging	1.00
R8065:Ripk4	UTSW	16	97763537	missense	probably damaging	0.97
R8067:Ripk4	UTSW	16	97763537	missense	probably damaging	0.97
R8191:Ripk4	UTSW	16	97763526	critical splice donor site	probably benign
Z1176:Ripk4	UTSW	16	97750102	missense	probably damaging	1.00
Z1177:Ripk4	UTSW	16	97755178	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CAGACAGGTCAATGAGGTCAGCAC -3'
(R):5'- ATGCCTGGTTGCCTCTGCACTATG -3'

Sequencing Primer
(F):5'- CCTCTATGAGCAGCTTGACAGTAG -3'
(R):5'- TGCACTATGCTGCCTGG -3'

Posted On

2013-04-11