Incidental Mutation 'R0112:Afdn'
ID20551
Institutional Source Beutler Lab
Gene Symbol Afdn
Ensembl Gene ENSMUSG00000068036
Gene Nameafadin, adherens junction formation factor
SynonymsAfadin, I-afadin, AF6, Mllt4, S-afadin, 5033403D15Rik
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0112 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location13760539-13906150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13884637 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1186 (S1186P)
Ref Sequence ENSEMBL: ENSMUSP00000128891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137708] [ENSMUST00000137784] [ENSMUST00000139666] [ENSMUST00000150848] [ENSMUST00000170827]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136087
Predicted Effect probably benign
Transcript: ENSMUST00000137531
SMART Domains Protein: ENSMUSP00000116711
Gene: ENSMUSG00000068036

DomainStartEndE-ValueType
coiled coil region 70 110 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137708
AA Change: S1201P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114485
Gene: ENSMUSG00000068036
AA Change: S1201P

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1616 1660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137784
AA Change: S1208P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119153
Gene: ENSMUSG00000068036
AA Change: S1208P

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 792 898 4.11e-39 SMART
PDZ 1023 1100 8.07e-19 SMART
low complexity region 1316 1325 N/A INTRINSIC
low complexity region 1393 1399 N/A INTRINSIC
coiled coil region 1416 1454 N/A INTRINSIC
coiled coil region 1530 1570 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
coiled coil region 1600 1672 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139666
AA Change: S1201P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118318
Gene: ENSMUSG00000068036
AA Change: S1201P

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1593 1665 N/A INTRINSIC
low complexity region 1692 1706 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150848
AA Change: S1186P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122447
Gene: ENSMUSG00000068036
AA Change: S1186P

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170827
AA Change: S1186P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128891
Gene: ENSMUSG00000068036
AA Change: S1186P

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Meta Mutation Damage Score 0.2618 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality, abnormal ectoderm development including disrupted cell junctions, and absence of the somites, notochord, allantois, and neural folds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fes T C 7: 80,384,005 D166G probably damaging Het
Fn1 A G 1: 71,609,653 S1366P probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Gp6 C A 7: 4,370,184 A247S probably benign Het
Gp6 G C 7: 4,371,627 P232A probably benign Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lmo7 A T 14: 101,887,193 R363* probably null Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1383 A T 11: 49,524,134 H137L possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Parg C A 14: 32,202,433 A63E probably damaging Het
Pik3cg A G 12: 32,195,715 probably benign Het
Ripk4 A G 16: 97,743,561 C629R probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slc19a1 T C 10: 77,042,165 I178T probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Tmem131l G A 3: 83,940,587 Q324* probably null Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Afdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Afdn APN 17 13884628 missense probably damaging 1.00
IGL00784:Afdn APN 17 13849263 splice site probably benign
IGL00971:Afdn APN 17 13852313 splice site probably benign
IGL01403:Afdn APN 17 13903870 missense probably damaging 1.00
IGL01944:Afdn APN 17 13810481 missense probably damaging 1.00
IGL02474:Afdn APN 17 13818229 missense probably damaging 1.00
IGL02615:Afdn APN 17 13825976 missense probably benign 0.00
IGL02664:Afdn APN 17 13852466 splice site probably benign
IGL03036:Afdn APN 17 13888088 missense probably benign 0.12
jubilee UTSW 17 13887986 missense probably damaging 1.00
IGL03134:Afdn UTSW 17 13846286 missense probably benign 0.04
R0226:Afdn UTSW 17 13899146 missense probably benign 0.00
R0305:Afdn UTSW 17 13888514 splice site probably null
R0310:Afdn UTSW 17 13885508 critical splice donor site probably null
R0711:Afdn UTSW 17 13852436 missense probably damaging 1.00
R0828:Afdn UTSW 17 13903998 missense probably damaging 1.00
R1268:Afdn UTSW 17 13887986 missense probably damaging 1.00
R1317:Afdn UTSW 17 13846273 missense probably benign 0.11
R1386:Afdn UTSW 17 13846536 missense probably damaging 1.00
R1438:Afdn UTSW 17 13855390 missense probably damaging 1.00
R1607:Afdn UTSW 17 13810501 missense probably damaging 1.00
R1819:Afdn UTSW 17 13850848 missense probably damaging 1.00
R1872:Afdn UTSW 17 13881316 missense probably damaging 1.00
R1880:Afdn UTSW 17 13852353 missense possibly damaging 0.84
R2049:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2140:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2142:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2162:Afdn UTSW 17 13896174 missense probably benign 0.01
R2221:Afdn UTSW 17 13883737 splice site probably benign
R2223:Afdn UTSW 17 13883737 splice site probably benign
R2291:Afdn UTSW 17 13888891 missense probably damaging 1.00
R2993:Afdn UTSW 17 13891000 critical splice donor site probably null
R3402:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3403:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3690:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3691:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3764:Afdn UTSW 17 13846589 missense probably benign 0.07
R3832:Afdn UTSW 17 13896174 missense probably benign 0.01
R4002:Afdn UTSW 17 13883917 missense probably damaging 1.00
R4440:Afdn UTSW 17 13850890 missense probably damaging 1.00
R4621:Afdn UTSW 17 13888820 missense probably damaging 1.00
R4935:Afdn UTSW 17 13890966 missense probably benign 0.30
R5279:Afdn UTSW 17 13888952 missense probably damaging 1.00
R5421:Afdn UTSW 17 13832406 missense probably benign 0.25
R5689:Afdn UTSW 17 13855359 missense probably damaging 1.00
R6332:Afdn UTSW 17 13810445 missense possibly damaging 0.92
R6369:Afdn UTSW 17 13835343 nonsense probably null
R6433:Afdn UTSW 17 13881299 missense probably damaging 1.00
R6467:Afdn UTSW 17 13804053 missense probably damaging 1.00
R6500:Afdn UTSW 17 13822372 missense possibly damaging 0.67
R6564:Afdn UTSW 17 13896089 missense probably benign
R6705:Afdn UTSW 17 13888021 missense probably benign 0.01
R6733:Afdn UTSW 17 13823353 missense probably benign 0.39
R6983:Afdn UTSW 17 13881321 missense probably damaging 1.00
R7089:Afdn UTSW 17 13890812 splice site probably null
R7161:Afdn UTSW 17 13888946 missense possibly damaging 0.55
R7175:Afdn UTSW 17 13888607 missense probably damaging 1.00
R7492:Afdn UTSW 17 13848376 critical splice donor site probably null
R7567:Afdn UTSW 17 13888808 missense probably benign 0.19
R7581:Afdn UTSW 17 13849238 missense probably damaging 1.00
R7694:Afdn UTSW 17 13888882 missense probably damaging 0.99
R7722:Afdn UTSW 17 13808969 missense probably benign 0.40
R7794:Afdn UTSW 17 13882433 missense probably damaging 1.00
R8039:Afdn UTSW 17 13899141 missense probably damaging 0.99
R8444:Afdn UTSW 17 13883800 missense probably benign 0.31
X0060:Afdn UTSW 17 13818170 nonsense probably null
X0064:Afdn UTSW 17 13888027 missense possibly damaging 0.60
Z1088:Afdn UTSW 17 13883780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCACATGATACAGTGCCTGC -3'
(R):5'- TCCCTGTCTCAAGAAGGGGAAATGG -3'

Sequencing Primer
(F):5'- GATACAGTGCCTGCATTTAAAGG -3'
(R):5'- GACCCTATGCTTTGAATGAGGAAC -3'
Posted On2013-04-11