Incidental Mutation 'R1838:Man2c1'
ID205512
Institutional Source Beutler Lab
Gene Symbol Man2c1
Ensembl Gene ENSMUSG00000032295
Gene Namemannosidase, alpha, class 2C, member 1
Synonyms
MMRRC Submission 039865-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1838 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57130690-57142722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57137337 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 354 (N354S)
Ref Sequence ENSEMBL: ENSMUSP00000125478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034836] [ENSMUST00000159130] [ENSMUST00000160147] [ENSMUST00000160584] [ENSMUST00000161182] [ENSMUST00000161338] [ENSMUST00000161393] [ENSMUST00000161663] [ENSMUST00000162915]
Predicted Effect probably benign
Transcript: ENSMUST00000034836
AA Change: N354S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034836
Gene: ENSMUSG00000032295
AA Change: N354S

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 4.3e-89 PFAM
Alpha-mann_mid 516 593 1.37e-26 SMART
low complexity region 603 613 N/A INTRINSIC
Pfam:Glyco_hydro_38C 619 1029 1.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159101
SMART Domains Protein: ENSMUSP00000124304
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 21 100 1.22e-32 SMART
low complexity region 110 120 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160042
Predicted Effect probably benign
Transcript: ENSMUST00000160147
AA Change: N354S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125478
Gene: ENSMUSG00000032295
AA Change: N354S

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 2.8e-86 PFAM
Alpha-mann_mid 516 595 1.22e-32 SMART
low complexity region 605 615 N/A INTRINSIC
Pfam:Glyco_hydro_38C 621 1031 1.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160280
Predicted Effect probably benign
Transcript: ENSMUST00000160426
SMART Domains Protein: ENSMUSP00000124005
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Alpha-mann_mid 24 77 4.48e-1 SMART
low complexity region 87 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160584
SMART Domains Protein: ENSMUSP00000123840
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161182
AA Change: N255S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124020
Gene: ENSMUSG00000032295
AA Change: N255S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38 175 411 9.4e-67 PFAM
Alpha-mann_mid 417 496 1.22e-32 SMART
low complexity region 506 516 N/A INTRINSIC
Pfam:Glyco_hydro_38C 522 932 1.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161338
Predicted Effect probably benign
Transcript: ENSMUST00000161393
Predicted Effect probably benign
Transcript: ENSMUST00000161663
AA Change: N395S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124124
Gene: ENSMUSG00000032295
AA Change: N395S

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 302 551 1.8e-81 PFAM
Alpha-mann_mid 557 636 1.22e-32 SMART
low complexity region 646 656 N/A INTRINSIC
Pfam:Glyco_hydro_38C 662 866 1.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162634
Predicted Effect probably benign
Transcript: ENSMUST00000162915
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Germ line null mutants display neuronal and glia degeneration, glycogen accumulation, and liver and kidney damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,727 D22G unknown Het
Abca4 G A 3: 122,128,305 R1170K probably benign Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adamtsl3 G T 7: 82,493,373 R267L probably damaging Het
Adgrb2 A T 4: 130,010,231 T717S probably benign Het
Adgrb3 A G 1: 25,084,270 S1417P probably damaging Het
Afg3l2 A T 18: 67,414,172 V561D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Btnl6 T A 17: 34,515,542 D82V probably damaging Het
Ccdc178 A G 18: 22,067,638 Y421H probably damaging Het
Cdc123 A T 2: 5,794,891 probably null Het
Cdhr5 C T 7: 141,272,603 V367I possibly damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Ctnna2 T C 6: 77,845,542 D26G probably damaging Het
Ctr9 G T 7: 111,052,303 R910L possibly damaging Het
Cyp2t4 G T 7: 27,158,416 R455L possibly damaging Het
Cyp3a13 A T 5: 137,911,632 probably null Het
Dennd3 T C 15: 73,565,100 S1059P probably damaging Het
Dennd4c A G 4: 86,825,178 T1135A probably benign Het
Dnah7b T C 1: 46,116,177 V295A probably benign Het
Dnah7b C A 1: 46,277,105 T3126K probably damaging Het
Ehbp1l1 C T 19: 5,717,691 E1195K probably benign Het
Exoc6b T A 6: 84,853,678 I447L probably benign Het
Glt1d1 G A 5: 127,678,129 V202I probably benign Het
Grk1 T C 8: 13,416,155 V533A possibly damaging Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Gzma T A 13: 113,095,984 I131F probably damaging Het
Helq A T 5: 100,771,879 L35* probably null Het
Hnrnpll T C 17: 80,038,623 N403S probably damaging Het
Hsf5 A G 11: 87,636,055 K518E probably benign Het
Ighe T A 12: 113,271,850 H258L unknown Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Ints13 C T 6: 146,566,611 A129T possibly damaging Het
Ipo7 T A 7: 110,042,109 H345Q probably damaging Het
Kcna2 A T 3: 107,104,512 E136D probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krtap4-9 A G 11: 99,785,396 probably benign Het
Lamc3 T C 2: 31,925,582 S1097P possibly damaging Het
Ldlrad2 A T 4: 137,572,170 N114K probably benign Het
Lrfn1 A T 7: 28,459,768 I371L probably damaging Het
Lrwd1 A G 5: 136,132,388 V240A probably benign Het
Lypd1 A T 1: 125,873,371 probably benign Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Map3k13 T C 16: 21,914,189 Y514H possibly damaging Het
Med15 T C 16: 17,653,562 D577G probably benign Het
Mroh4 A T 15: 74,616,113 M320K probably benign Het
Ms4a10 T A 19: 10,964,047 D186V possibly damaging Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Myo5c A T 9: 75,273,553 R741S probably damaging Het
Naip6 T C 13: 100,316,136 D139G probably damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Olfr1252 A T 2: 89,721,709 M134K probably damaging Het
Olfr1370 A T 13: 21,072,425 L292* probably null Het
Olfr229 A T 9: 39,909,841 I13F possibly damaging Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Pcdhb3 A G 18: 37,301,317 D112G probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Pgm3 C T 9: 86,569,233 V123I probably benign Het
Pms1 A C 1: 53,192,098 probably null Het
Prl2b1 A G 13: 27,388,566 S14P possibly damaging Het
Prune2 T A 19: 17,199,878 W212R probably damaging Het
Rabgef1 A G 5: 130,213,021 E422G probably benign Het
Ralyl A G 3: 14,143,412 E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,651,680 probably benign Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Slc16a7 C T 10: 125,231,198 V191M probably damaging Het
Slc34a2 A T 5: 53,058,436 H63L probably benign Het
Smpd4 G A 16: 17,642,302 probably null Het
Sp3 A G 2: 72,938,176 S748P possibly damaging Het
Spata31d1b G A 13: 59,715,857 C273Y probably benign Het
Spata31d1b G A 13: 59,717,465 R809K probably benign Het
Tmco5 A T 2: 116,880,879 E90V probably damaging Het
Tnxb A T 17: 34,678,910 D844V probably damaging Het
Tpi1 T C 6: 124,814,152 T41A probably benign Het
Ttn T C 2: 76,727,192 I29853V probably damaging Het
Vmn2r26 C T 6: 124,024,771 T5I probably benign Het
Wdr95 A G 5: 149,599,366 D663G probably benign Het
Zbtb39 T C 10: 127,742,700 F381S probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp646 T A 7: 127,879,739 Y363N probably damaging Het
Zfp712 A C 13: 67,042,047 C139G probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Man2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Man2c1 APN 9 57141819 missense probably benign
IGL01408:Man2c1 APN 9 57141600 missense probably damaging 1.00
IGL01618:Man2c1 APN 9 57141556 unclassified probably benign
IGL01750:Man2c1 APN 9 57140780 critical splice donor site probably null
IGL01796:Man2c1 APN 9 57137960 missense possibly damaging 0.52
IGL02661:Man2c1 APN 9 57137482 missense probably damaging 1.00
IGL03166:Man2c1 APN 9 57139098 missense probably damaging 1.00
IGL03176:Man2c1 APN 9 57140746 missense probably benign 0.05
IGL03209:Man2c1 APN 9 57141830 missense probably benign 0.00
R0014:Man2c1 UTSW 9 57139701 missense probably benign 0.00
R0329:Man2c1 UTSW 9 57141183 missense probably benign 0.40
R0432:Man2c1 UTSW 9 57135597 missense probably damaging 1.00
R1448:Man2c1 UTSW 9 57135219 missense probably benign 0.23
R1616:Man2c1 UTSW 9 57135509 missense probably benign 0.00
R2511:Man2c1 UTSW 9 57141388 splice site probably null
R3751:Man2c1 UTSW 9 57140774 missense probably damaging 1.00
R3771:Man2c1 UTSW 9 57140377 unclassified probably benign
R3772:Man2c1 UTSW 9 57140377 unclassified probably benign
R4110:Man2c1 UTSW 9 57136771 missense probably damaging 0.98
R4116:Man2c1 UTSW 9 57140305 critical splice donor site probably null
R4167:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4169:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4170:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4405:Man2c1 UTSW 9 57139083 missense probably damaging 0.98
R4551:Man2c1 UTSW 9 57131161 missense probably damaging 1.00
R4618:Man2c1 UTSW 9 57142155 unclassified probably null
R4798:Man2c1 UTSW 9 57141185 nonsense probably null
R4903:Man2c1 UTSW 9 57138956 missense probably benign 0.08
R5030:Man2c1 UTSW 9 57140639 missense probably benign 0.00
R5079:Man2c1 UTSW 9 57136716 missense probably damaging 1.00
R5086:Man2c1 UTSW 9 57131640 missense probably damaging 0.96
R6430:Man2c1 UTSW 9 57131233 missense possibly damaging 0.91
R6695:Man2c1 UTSW 9 57141591 missense probably benign 0.03
R6743:Man2c1 UTSW 9 57135565 missense probably benign 0.41
R7011:Man2c1 UTSW 9 57137833 missense probably damaging 1.00
R7493:Man2c1 UTSW 9 57141128 missense probably damaging 0.98
R7513:Man2c1 UTSW 9 57139399 missense probably benign 0.44
R7527:Man2c1 UTSW 9 57137816 nonsense probably null
R7540:Man2c1 UTSW 9 57140275 missense probably damaging 1.00
R7760:Man2c1 UTSW 9 57139363 missense probably benign 0.23
R7868:Man2c1 UTSW 9 57137986 missense probably damaging 0.99
R7951:Man2c1 UTSW 9 57137986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGTTAGTGCACCCATTG -3'
(R):5'- AGTTTCTGGGTCAGGAAGCG -3'

Sequencing Primer
(F):5'- TGCACTTCTACAACAAAGTGAAG -3'
(R):5'- ACAGCCTTGCATGATCTGG -3'
Posted On2014-06-23