Incidental Mutation 'R1838:Slc16a7'
ID 205522
Institutional Source Beutler Lab
Gene Symbol Slc16a7
Ensembl Gene ENSMUSG00000020102
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms 4921534N07Rik, 9030411M13Rik, D630004K10Rik, MCT2
MMRRC Submission 039865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R1838 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 125055139-125225334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 125067067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 191 (V191M)
Ref Sequence ENSEMBL: ENSMUSP00000147968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781]
AlphaFold O70451
Predicted Effect probably damaging
Transcript: ENSMUST00000063318
AA Change: V191M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102
AA Change: V191M

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 2e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105257
AA Change: V191M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102
AA Change: V191M

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210780
AA Change: V191M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211781
AA Change: V191M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,603,690 (GRCm39) D22G unknown Het
Abca4 G A 3: 121,921,954 (GRCm39) R1170K probably benign Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adamtsl3 G T 7: 82,142,581 (GRCm39) R267L probably damaging Het
Adgrb2 A T 4: 129,904,024 (GRCm39) T717S probably benign Het
Adgrb3 A G 1: 25,123,351 (GRCm39) S1417P probably damaging Het
Afg3l2 A T 18: 67,547,242 (GRCm39) V561D probably damaging Het
Atp13a2 T A 4: 140,721,643 (GRCm39) Y244* probably null Het
BB014433 C G 8: 15,092,629 (GRCm39) V75L unknown Het
Btnl6 T A 17: 34,734,516 (GRCm39) D82V probably damaging Het
Ccdc178 A G 18: 22,200,695 (GRCm39) Y421H probably damaging Het
Cdc123 A T 2: 5,799,702 (GRCm39) probably null Het
Cdhr5 C T 7: 140,852,516 (GRCm39) V367I possibly damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Ctnna2 T C 6: 77,822,525 (GRCm39) D26G probably damaging Het
Ctr9 G T 7: 110,651,510 (GRCm39) R910L possibly damaging Het
Cyp2t4 G T 7: 26,857,841 (GRCm39) R455L possibly damaging Het
Cyp3a13 A T 5: 137,909,894 (GRCm39) probably null Het
Dennd3 T C 15: 73,436,949 (GRCm39) S1059P probably damaging Het
Dennd4c A G 4: 86,743,415 (GRCm39) T1135A probably benign Het
Dnah7b T C 1: 46,155,337 (GRCm39) V295A probably benign Het
Dnah7b C A 1: 46,316,265 (GRCm39) T3126K probably damaging Het
Ehbp1l1 C T 19: 5,767,719 (GRCm39) E1195K probably benign Het
Exoc6b T A 6: 84,830,660 (GRCm39) I447L probably benign Het
Glt1d1 G A 5: 127,755,193 (GRCm39) V202I probably benign Het
Grk1 T C 8: 13,466,155 (GRCm39) V533A possibly damaging Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Gzma T A 13: 113,232,518 (GRCm39) I131F probably damaging Het
Helq A T 5: 100,919,745 (GRCm39) L35* probably null Het
Hnrnpll T C 17: 80,346,052 (GRCm39) N403S probably damaging Het
Hsf5 A G 11: 87,526,881 (GRCm39) K518E probably benign Het
Ighe T A 12: 113,235,470 (GRCm39) H258L unknown Het
Il6ra T C 3: 89,797,579 (GRCm39) D96G probably benign Het
Ints13 C T 6: 146,468,109 (GRCm39) A129T possibly damaging Het
Ipo7 T A 7: 109,641,316 (GRCm39) H345Q probably damaging Het
Kcna2 A T 3: 107,011,828 (GRCm39) E136D probably benign Het
Kif5a G A 10: 127,072,684 (GRCm39) Q702* probably null Het
Klhdc7a G T 4: 139,694,381 (GRCm39) P189T probably benign Het
Krtap4-9 A G 11: 99,676,222 (GRCm39) probably benign Het
Lamc3 T C 2: 31,815,594 (GRCm39) S1097P possibly damaging Het
Ldlrad2 A T 4: 137,299,481 (GRCm39) N114K probably benign Het
Lrfn1 A T 7: 28,159,193 (GRCm39) I371L probably damaging Het
Lrwd1 A G 5: 136,161,242 (GRCm39) V240A probably benign Het
Lypd1 A T 1: 125,801,108 (GRCm39) probably benign Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Man2c1 A G 9: 57,044,621 (GRCm39) N354S probably benign Het
Map3k13 T C 16: 21,732,939 (GRCm39) Y514H possibly damaging Het
Med15 T C 16: 17,471,426 (GRCm39) D577G probably benign Het
Mroh4 A T 15: 74,487,962 (GRCm39) M320K probably benign Het
Ms4a10 T A 19: 10,941,411 (GRCm39) D186V possibly damaging Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Myo5c A T 9: 75,180,835 (GRCm39) R741S probably damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Naip6 T C 13: 100,452,644 (GRCm39) D139G probably damaging Het
Or10s1 A T 9: 39,985,605 (GRCm39) M5L probably benign Het
Or2p2 A T 13: 21,256,595 (GRCm39) L292* probably null Het
Or4a79 A T 2: 89,552,053 (GRCm39) M134K probably damaging Het
Or8g2 A T 9: 39,821,137 (GRCm39) I13F possibly damaging Het
Pcdhb3 A G 18: 37,434,370 (GRCm39) D112G probably benign Het
Pdpr C A 8: 111,861,366 (GRCm39) P787T probably damaging Het
Pgm3 C T 9: 86,451,286 (GRCm39) V123I probably benign Het
Pms1 A C 1: 53,231,257 (GRCm39) probably null Het
Prl2b1 A G 13: 27,572,549 (GRCm39) S14P possibly damaging Het
Prune2 T A 19: 17,177,242 (GRCm39) W212R probably damaging Het
Rabgef1 A G 5: 130,241,862 (GRCm39) E422G probably benign Het
Ralyl A G 3: 14,208,472 (GRCm39) E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,558,962 (GRCm39) probably benign Het
Rit1 C G 3: 88,636,477 (GRCm39) T127S probably damaging Het
Slc34a2 A T 5: 53,215,778 (GRCm39) H63L probably benign Het
Smpd4 G A 16: 17,460,166 (GRCm39) probably null Het
Sp3 A G 2: 72,768,520 (GRCm39) S748P possibly damaging Het
Spata31d1b G A 13: 59,863,671 (GRCm39) C273Y probably benign Het
Spata31d1b G A 13: 59,865,279 (GRCm39) R809K probably benign Het
Tmco5 A T 2: 116,711,360 (GRCm39) E90V probably damaging Het
Tnxb A T 17: 34,897,884 (GRCm39) D844V probably damaging Het
Tpi1 T C 6: 124,791,115 (GRCm39) T41A probably benign Het
Ttn T C 2: 76,557,536 (GRCm39) I29853V probably damaging Het
Vmn2r26 C T 6: 124,001,730 (GRCm39) T5I probably benign Het
Wdr95 A G 5: 149,522,831 (GRCm39) D663G probably benign Het
Zbtb39 T C 10: 127,578,569 (GRCm39) F381S probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp646 T A 7: 127,478,911 (GRCm39) Y363N probably damaging Het
Zfp712 A C 13: 67,190,111 (GRCm39) C139G probably damaging Het
Zfp958 A G 8: 4,678,590 (GRCm39) H205R probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Slc16a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Slc16a7 APN 10 125,066,803 (GRCm39) missense probably benign 0.16
IGL02228:Slc16a7 APN 10 125,066,667 (GRCm39) missense probably damaging 1.00
IGL02500:Slc16a7 APN 10 125,066,802 (GRCm39) missense probably damaging 1.00
IGL03277:Slc16a7 APN 10 125,066,560 (GRCm39) missense probably benign 0.00
R0044:Slc16a7 UTSW 10 125,063,951 (GRCm39) missense probably benign 0.01
R0076:Slc16a7 UTSW 10 125,063,939 (GRCm39) missense probably benign 0.34
R0285:Slc16a7 UTSW 10 125,130,500 (GRCm39) missense probably benign 0.22
R0546:Slc16a7 UTSW 10 125,066,742 (GRCm39) missense probably benign 0.02
R0898:Slc16a7 UTSW 10 125,069,370 (GRCm39) missense possibly damaging 0.46
R1123:Slc16a7 UTSW 10 125,067,016 (GRCm39) missense probably benign 0.00
R1173:Slc16a7 UTSW 10 125,067,241 (GRCm39) missense possibly damaging 0.82
R1459:Slc16a7 UTSW 10 125,066,489 (GRCm39) nonsense probably null
R1554:Slc16a7 UTSW 10 125,066,791 (GRCm39) missense possibly damaging 0.70
R3545:Slc16a7 UTSW 10 125,130,569 (GRCm39) nonsense probably null
R3546:Slc16a7 UTSW 10 125,130,569 (GRCm39) nonsense probably null
R3547:Slc16a7 UTSW 10 125,130,569 (GRCm39) nonsense probably null
R3934:Slc16a7 UTSW 10 125,066,712 (GRCm39) missense probably damaging 1.00
R3935:Slc16a7 UTSW 10 125,066,712 (GRCm39) missense probably damaging 1.00
R4499:Slc16a7 UTSW 10 125,064,056 (GRCm39) missense probably damaging 1.00
R4512:Slc16a7 UTSW 10 125,069,308 (GRCm39) splice site probably null
R4513:Slc16a7 UTSW 10 125,069,308 (GRCm39) splice site probably null
R4514:Slc16a7 UTSW 10 125,069,308 (GRCm39) splice site probably null
R5157:Slc16a7 UTSW 10 125,069,333 (GRCm39) nonsense probably null
R5247:Slc16a7 UTSW 10 125,067,183 (GRCm39) missense probably damaging 1.00
R5385:Slc16a7 UTSW 10 125,130,473 (GRCm39) missense possibly damaging 0.85
R6198:Slc16a7 UTSW 10 125,064,084 (GRCm39) missense probably benign
R6263:Slc16a7 UTSW 10 125,130,508 (GRCm39) missense probably benign 0.16
R6430:Slc16a7 UTSW 10 125,066,887 (GRCm39) missense probably damaging 0.97
R7450:Slc16a7 UTSW 10 125,063,920 (GRCm39) missense probably benign 0.00
R7680:Slc16a7 UTSW 10 125,066,805 (GRCm39) missense probably benign 0.19
R8125:Slc16a7 UTSW 10 125,164,202 (GRCm39) critical splice donor site probably null
R9133:Slc16a7 UTSW 10 125,066,536 (GRCm39) missense probably benign 0.00
R9301:Slc16a7 UTSW 10 125,066,880 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTTAGCGTACTGAGCCAAG -3'
(R):5'- GCAACCAGCCTTAACAATAATTGG -3'

Sequencing Primer
(F):5'- TGACGTTTCCAGATAGGTAGATC -3'
(R):5'- GCTGGAAGTCCTGTTTTC -3'
Posted On 2014-06-23