Incidental Mutation 'R1838:Spata31d1b'
ID 205534
Institutional Source Beutler Lab
Gene Symbol Spata31d1b
Ensembl Gene ENSMUSG00000091311
Gene Name spermatogenesis associated 31 subfamily D, member 1B
Synonyms Gm4934, Fam75d1b
MMRRC Submission 039865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R1838 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 59860098-59867103 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 59863671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 273 (C273Y)
Ref Sequence ENSEMBL: ENSMUSP00000130813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165133]
AlphaFold E9QA57
Predicted Effect probably benign
Transcript: ENSMUST00000165133
AA Change: C273Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130813
Gene: ENSMUSG00000091311
AA Change: C273Y

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 65 149 3.9e-10 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 206 229 N/A INTRINSIC
low complexity region 352 360 N/A INTRINSIC
Pfam:FAM75 402 774 1.1e-116 PFAM
low complexity region 883 895 N/A INTRINSIC
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1152 1162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,603,690 (GRCm39) D22G unknown Het
Abca4 G A 3: 121,921,954 (GRCm39) R1170K probably benign Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adamtsl3 G T 7: 82,142,581 (GRCm39) R267L probably damaging Het
Adgrb2 A T 4: 129,904,024 (GRCm39) T717S probably benign Het
Adgrb3 A G 1: 25,123,351 (GRCm39) S1417P probably damaging Het
Afg3l2 A T 18: 67,547,242 (GRCm39) V561D probably damaging Het
Atp13a2 T A 4: 140,721,643 (GRCm39) Y244* probably null Het
BB014433 C G 8: 15,092,629 (GRCm39) V75L unknown Het
Btnl6 T A 17: 34,734,516 (GRCm39) D82V probably damaging Het
Ccdc178 A G 18: 22,200,695 (GRCm39) Y421H probably damaging Het
Cdc123 A T 2: 5,799,702 (GRCm39) probably null Het
Cdhr5 C T 7: 140,852,516 (GRCm39) V367I possibly damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Ctnna2 T C 6: 77,822,525 (GRCm39) D26G probably damaging Het
Ctr9 G T 7: 110,651,510 (GRCm39) R910L possibly damaging Het
Cyp2t4 G T 7: 26,857,841 (GRCm39) R455L possibly damaging Het
Cyp3a13 A T 5: 137,909,894 (GRCm39) probably null Het
Dennd3 T C 15: 73,436,949 (GRCm39) S1059P probably damaging Het
Dennd4c A G 4: 86,743,415 (GRCm39) T1135A probably benign Het
Dnah7b T C 1: 46,155,337 (GRCm39) V295A probably benign Het
Dnah7b C A 1: 46,316,265 (GRCm39) T3126K probably damaging Het
Ehbp1l1 C T 19: 5,767,719 (GRCm39) E1195K probably benign Het
Exoc6b T A 6: 84,830,660 (GRCm39) I447L probably benign Het
Glt1d1 G A 5: 127,755,193 (GRCm39) V202I probably benign Het
Grk1 T C 8: 13,466,155 (GRCm39) V533A possibly damaging Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Gzma T A 13: 113,232,518 (GRCm39) I131F probably damaging Het
Helq A T 5: 100,919,745 (GRCm39) L35* probably null Het
Hnrnpll T C 17: 80,346,052 (GRCm39) N403S probably damaging Het
Hsf5 A G 11: 87,526,881 (GRCm39) K518E probably benign Het
Ighe T A 12: 113,235,470 (GRCm39) H258L unknown Het
Il6ra T C 3: 89,797,579 (GRCm39) D96G probably benign Het
Ints13 C T 6: 146,468,109 (GRCm39) A129T possibly damaging Het
Ipo7 T A 7: 109,641,316 (GRCm39) H345Q probably damaging Het
Kcna2 A T 3: 107,011,828 (GRCm39) E136D probably benign Het
Kif5a G A 10: 127,072,684 (GRCm39) Q702* probably null Het
Klhdc7a G T 4: 139,694,381 (GRCm39) P189T probably benign Het
Krtap4-9 A G 11: 99,676,222 (GRCm39) probably benign Het
Lamc3 T C 2: 31,815,594 (GRCm39) S1097P possibly damaging Het
Ldlrad2 A T 4: 137,299,481 (GRCm39) N114K probably benign Het
Lrfn1 A T 7: 28,159,193 (GRCm39) I371L probably damaging Het
Lrwd1 A G 5: 136,161,242 (GRCm39) V240A probably benign Het
Lypd1 A T 1: 125,801,108 (GRCm39) probably benign Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Man2c1 A G 9: 57,044,621 (GRCm39) N354S probably benign Het
Map3k13 T C 16: 21,732,939 (GRCm39) Y514H possibly damaging Het
Med15 T C 16: 17,471,426 (GRCm39) D577G probably benign Het
Mroh4 A T 15: 74,487,962 (GRCm39) M320K probably benign Het
Ms4a10 T A 19: 10,941,411 (GRCm39) D186V possibly damaging Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Myo5c A T 9: 75,180,835 (GRCm39) R741S probably damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Naip6 T C 13: 100,452,644 (GRCm39) D139G probably damaging Het
Or10s1 A T 9: 39,985,605 (GRCm39) M5L probably benign Het
Or2p2 A T 13: 21,256,595 (GRCm39) L292* probably null Het
Or4a79 A T 2: 89,552,053 (GRCm39) M134K probably damaging Het
Or8g2 A T 9: 39,821,137 (GRCm39) I13F possibly damaging Het
Pcdhb3 A G 18: 37,434,370 (GRCm39) D112G probably benign Het
Pdpr C A 8: 111,861,366 (GRCm39) P787T probably damaging Het
Pgm3 C T 9: 86,451,286 (GRCm39) V123I probably benign Het
Pms1 A C 1: 53,231,257 (GRCm39) probably null Het
Prl2b1 A G 13: 27,572,549 (GRCm39) S14P possibly damaging Het
Prune2 T A 19: 17,177,242 (GRCm39) W212R probably damaging Het
Rabgef1 A G 5: 130,241,862 (GRCm39) E422G probably benign Het
Ralyl A G 3: 14,208,472 (GRCm39) E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,558,962 (GRCm39) probably benign Het
Rit1 C G 3: 88,636,477 (GRCm39) T127S probably damaging Het
Slc16a7 C T 10: 125,067,067 (GRCm39) V191M probably damaging Het
Slc34a2 A T 5: 53,215,778 (GRCm39) H63L probably benign Het
Smpd4 G A 16: 17,460,166 (GRCm39) probably null Het
Sp3 A G 2: 72,768,520 (GRCm39) S748P possibly damaging Het
Tmco5 A T 2: 116,711,360 (GRCm39) E90V probably damaging Het
Tnxb A T 17: 34,897,884 (GRCm39) D844V probably damaging Het
Tpi1 T C 6: 124,791,115 (GRCm39) T41A probably benign Het
Ttn T C 2: 76,557,536 (GRCm39) I29853V probably damaging Het
Vmn2r26 C T 6: 124,001,730 (GRCm39) T5I probably benign Het
Wdr95 A G 5: 149,522,831 (GRCm39) D663G probably benign Het
Zbtb39 T C 10: 127,578,569 (GRCm39) F381S probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp646 T A 7: 127,478,911 (GRCm39) Y363N probably damaging Het
Zfp712 A C 13: 67,190,111 (GRCm39) C139G probably damaging Het
Zfp958 A G 8: 4,678,590 (GRCm39) H205R probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Spata31d1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Spata31d1b APN 13 59,860,280 (GRCm39) missense probably benign 0.06
IGL02317:Spata31d1b APN 13 59,865,854 (GRCm39) missense probably damaging 0.99
IGL02885:Spata31d1b APN 13 59,866,941 (GRCm39) utr 3 prime probably benign
R0017:Spata31d1b UTSW 13 59,863,883 (GRCm39) missense probably benign
R0071:Spata31d1b UTSW 13 59,863,163 (GRCm39) missense probably benign 0.26
R0071:Spata31d1b UTSW 13 59,863,163 (GRCm39) missense probably benign 0.26
R0595:Spata31d1b UTSW 13 59,864,091 (GRCm39) missense probably benign 0.09
R0961:Spata31d1b UTSW 13 59,865,618 (GRCm39) missense possibly damaging 0.91
R1054:Spata31d1b UTSW 13 59,865,332 (GRCm39) missense probably damaging 0.96
R1124:Spata31d1b UTSW 13 59,864,468 (GRCm39) missense probably benign
R1338:Spata31d1b UTSW 13 59,865,975 (GRCm39) frame shift probably null
R1539:Spata31d1b UTSW 13 59,863,733 (GRCm39) missense possibly damaging 0.46
R1662:Spata31d1b UTSW 13 59,864,442 (GRCm39) missense probably benign 0.00
R1688:Spata31d1b UTSW 13 59,863,274 (GRCm39) missense possibly damaging 0.61
R1776:Spata31d1b UTSW 13 59,864,381 (GRCm39) missense probably benign
R1793:Spata31d1b UTSW 13 59,863,779 (GRCm39) missense probably benign
R1838:Spata31d1b UTSW 13 59,865,279 (GRCm39) missense probably benign 0.00
R1861:Spata31d1b UTSW 13 59,865,150 (GRCm39) missense possibly damaging 0.64
R1903:Spata31d1b UTSW 13 59,865,882 (GRCm39) missense probably damaging 0.99
R1940:Spata31d1b UTSW 13 59,865,835 (GRCm39) missense possibly damaging 0.91
R1994:Spata31d1b UTSW 13 59,864,194 (GRCm39) missense probably benign
R1995:Spata31d1b UTSW 13 59,864,194 (GRCm39) missense probably benign
R2407:Spata31d1b UTSW 13 59,864,660 (GRCm39) missense possibly damaging 0.64
R3692:Spata31d1b UTSW 13 59,865,705 (GRCm39) missense probably benign 0.03
R4576:Spata31d1b UTSW 13 59,864,675 (GRCm39) missense probably damaging 0.98
R4734:Spata31d1b UTSW 13 59,866,172 (GRCm39) missense probably damaging 1.00
R4742:Spata31d1b UTSW 13 59,864,426 (GRCm39) missense probably damaging 0.98
R4749:Spata31d1b UTSW 13 59,866,172 (GRCm39) missense probably damaging 1.00
R4806:Spata31d1b UTSW 13 59,863,535 (GRCm39) missense probably benign 0.32
R4808:Spata31d1b UTSW 13 59,863,535 (GRCm39) missense probably benign 0.32
R4844:Spata31d1b UTSW 13 59,866,169 (GRCm39) missense possibly damaging 0.85
R4942:Spata31d1b UTSW 13 59,864,917 (GRCm39) missense possibly damaging 0.70
R4953:Spata31d1b UTSW 13 59,864,097 (GRCm39) missense probably damaging 0.96
R5093:Spata31d1b UTSW 13 59,863,838 (GRCm39) missense possibly damaging 0.84
R5169:Spata31d1b UTSW 13 59,864,309 (GRCm39) missense probably damaging 1.00
R5384:Spata31d1b UTSW 13 59,866,032 (GRCm39) missense possibly damaging 0.68
R5386:Spata31d1b UTSW 13 59,866,866 (GRCm39) missense possibly damaging 0.95
R5502:Spata31d1b UTSW 13 59,864,486 (GRCm39) missense probably damaging 1.00
R5751:Spata31d1b UTSW 13 59,866,787 (GRCm39) missense probably benign 0.03
R6054:Spata31d1b UTSW 13 59,863,464 (GRCm39) missense probably benign
R6433:Spata31d1b UTSW 13 59,864,999 (GRCm39) missense probably damaging 0.99
R6571:Spata31d1b UTSW 13 59,865,269 (GRCm39) missense probably benign
R6980:Spata31d1b UTSW 13 59,863,236 (GRCm39) missense probably benign 0.26
R7047:Spata31d1b UTSW 13 59,860,249 (GRCm39) missense probably damaging 1.00
R7064:Spata31d1b UTSW 13 59,863,955 (GRCm39) missense probably benign
R7147:Spata31d1b UTSW 13 59,866,028 (GRCm39) missense probably benign 0.28
R7273:Spata31d1b UTSW 13 59,865,446 (GRCm39) missense probably benign
R7359:Spata31d1b UTSW 13 59,860,304 (GRCm39) missense probably damaging 1.00
R7457:Spata31d1b UTSW 13 59,864,723 (GRCm39) missense probably damaging 0.99
R7469:Spata31d1b UTSW 13 59,863,278 (GRCm39) missense probably benign 0.04
R7519:Spata31d1b UTSW 13 59,864,726 (GRCm39) missense probably benign 0.43
R7548:Spata31d1b UTSW 13 59,864,468 (GRCm39) missense probably benign
R7586:Spata31d1b UTSW 13 59,866,194 (GRCm39) missense probably damaging 1.00
R7657:Spata31d1b UTSW 13 59,863,577 (GRCm39) missense possibly damaging 0.46
R7778:Spata31d1b UTSW 13 59,865,047 (GRCm39) missense possibly damaging 0.65
R7824:Spata31d1b UTSW 13 59,865,047 (GRCm39) missense possibly damaging 0.65
R7989:Spata31d1b UTSW 13 59,866,182 (GRCm39) missense possibly damaging 0.94
R8078:Spata31d1b UTSW 13 59,863,263 (GRCm39) missense probably damaging 0.99
R8176:Spata31d1b UTSW 13 59,865,117 (GRCm39) missense probably benign
R8530:Spata31d1b UTSW 13 59,864,964 (GRCm39) missense unknown
R8776:Spata31d1b UTSW 13 59,863,283 (GRCm39) missense probably benign 0.00
R8776-TAIL:Spata31d1b UTSW 13 59,863,283 (GRCm39) missense probably benign 0.00
R9385:Spata31d1b UTSW 13 59,863,403 (GRCm39) missense probably damaging 0.99
R9476:Spata31d1b UTSW 13 59,863,467 (GRCm39) missense probably benign 0.08
R9522:Spata31d1b UTSW 13 59,864,780 (GRCm39) missense probably benign 0.00
R9786:Spata31d1b UTSW 13 59,866,155 (GRCm39) missense possibly damaging 0.56
R9789:Spata31d1b UTSW 13 59,860,196 (GRCm39) missense probably benign 0.03
Z1177:Spata31d1b UTSW 13 59,866,674 (GRCm39) missense probably benign 0.17
Z1177:Spata31d1b UTSW 13 59,863,265 (GRCm39) missense probably benign 0.44
Z1177:Spata31d1b UTSW 13 59,860,223 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAGAAGGCTTCTACTCAGC -3'
(R):5'- TTCACGGCATTAGAGTTGGG -3'

Sequencing Primer
(F):5'- GCTGCACGACTCTCTGACAC -3'
(R):5'- AAGAGGTATCCAGGCTCTAC -3'
Posted On 2014-06-23