Incidental Mutation 'R1838:Adam28'
ID 205541
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Name a disintegrin and metallopeptidase domain 28
Synonyms MDC-L, D430033C21Rik, Dtgn1, C130072N01Rik
MMRRC Submission 039865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R1838 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 68843476-68893291 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68876659 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 197 (N197S)
Ref Sequence ENSEMBL: ENSMUSP00000153354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
AlphaFold Q9JLN6
Predicted Effect possibly damaging
Transcript: ENSMUST00000022642
AA Change: N197S

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: N197S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111072
AA Change: N197S

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: N197S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224039
AA Change: N197S

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224131
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,603,690 (GRCm39) D22G unknown Het
Abca4 G A 3: 121,921,954 (GRCm39) R1170K probably benign Het
Adamtsl3 G T 7: 82,142,581 (GRCm39) R267L probably damaging Het
Adgrb2 A T 4: 129,904,024 (GRCm39) T717S probably benign Het
Adgrb3 A G 1: 25,123,351 (GRCm39) S1417P probably damaging Het
Afg3l2 A T 18: 67,547,242 (GRCm39) V561D probably damaging Het
Atp13a2 T A 4: 140,721,643 (GRCm39) Y244* probably null Het
BB014433 C G 8: 15,092,629 (GRCm39) V75L unknown Het
Btnl6 T A 17: 34,734,516 (GRCm39) D82V probably damaging Het
Ccdc178 A G 18: 22,200,695 (GRCm39) Y421H probably damaging Het
Cdc123 A T 2: 5,799,702 (GRCm39) probably null Het
Cdhr5 C T 7: 140,852,516 (GRCm39) V367I possibly damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Ctnna2 T C 6: 77,822,525 (GRCm39) D26G probably damaging Het
Ctr9 G T 7: 110,651,510 (GRCm39) R910L possibly damaging Het
Cyp2t4 G T 7: 26,857,841 (GRCm39) R455L possibly damaging Het
Cyp3a13 A T 5: 137,909,894 (GRCm39) probably null Het
Dennd3 T C 15: 73,436,949 (GRCm39) S1059P probably damaging Het
Dennd4c A G 4: 86,743,415 (GRCm39) T1135A probably benign Het
Dnah7b T C 1: 46,155,337 (GRCm39) V295A probably benign Het
Dnah7b C A 1: 46,316,265 (GRCm39) T3126K probably damaging Het
Ehbp1l1 C T 19: 5,767,719 (GRCm39) E1195K probably benign Het
Exoc6b T A 6: 84,830,660 (GRCm39) I447L probably benign Het
Glt1d1 G A 5: 127,755,193 (GRCm39) V202I probably benign Het
Grk1 T C 8: 13,466,155 (GRCm39) V533A possibly damaging Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Gzma T A 13: 113,232,518 (GRCm39) I131F probably damaging Het
Helq A T 5: 100,919,745 (GRCm39) L35* probably null Het
Hnrnpll T C 17: 80,346,052 (GRCm39) N403S probably damaging Het
Hsf5 A G 11: 87,526,881 (GRCm39) K518E probably benign Het
Ighe T A 12: 113,235,470 (GRCm39) H258L unknown Het
Il6ra T C 3: 89,797,579 (GRCm39) D96G probably benign Het
Ints13 C T 6: 146,468,109 (GRCm39) A129T possibly damaging Het
Ipo7 T A 7: 109,641,316 (GRCm39) H345Q probably damaging Het
Kcna2 A T 3: 107,011,828 (GRCm39) E136D probably benign Het
Kif5a G A 10: 127,072,684 (GRCm39) Q702* probably null Het
Klhdc7a G T 4: 139,694,381 (GRCm39) P189T probably benign Het
Krtap4-9 A G 11: 99,676,222 (GRCm39) probably benign Het
Lamc3 T C 2: 31,815,594 (GRCm39) S1097P possibly damaging Het
Ldlrad2 A T 4: 137,299,481 (GRCm39) N114K probably benign Het
Lrfn1 A T 7: 28,159,193 (GRCm39) I371L probably damaging Het
Lrwd1 A G 5: 136,161,242 (GRCm39) V240A probably benign Het
Lypd1 A T 1: 125,801,108 (GRCm39) probably benign Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Man2c1 A G 9: 57,044,621 (GRCm39) N354S probably benign Het
Map3k13 T C 16: 21,732,939 (GRCm39) Y514H possibly damaging Het
Med15 T C 16: 17,471,426 (GRCm39) D577G probably benign Het
Mroh4 A T 15: 74,487,962 (GRCm39) M320K probably benign Het
Ms4a10 T A 19: 10,941,411 (GRCm39) D186V possibly damaging Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Myo5c A T 9: 75,180,835 (GRCm39) R741S probably damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Naip6 T C 13: 100,452,644 (GRCm39) D139G probably damaging Het
Or10s1 A T 9: 39,985,605 (GRCm39) M5L probably benign Het
Or2p2 A T 13: 21,256,595 (GRCm39) L292* probably null Het
Or4a79 A T 2: 89,552,053 (GRCm39) M134K probably damaging Het
Or8g2 A T 9: 39,821,137 (GRCm39) I13F possibly damaging Het
Pcdhb3 A G 18: 37,434,370 (GRCm39) D112G probably benign Het
Pdpr C A 8: 111,861,366 (GRCm39) P787T probably damaging Het
Pgm3 C T 9: 86,451,286 (GRCm39) V123I probably benign Het
Pms1 A C 1: 53,231,257 (GRCm39) probably null Het
Prl2b1 A G 13: 27,572,549 (GRCm39) S14P possibly damaging Het
Prune2 T A 19: 17,177,242 (GRCm39) W212R probably damaging Het
Rabgef1 A G 5: 130,241,862 (GRCm39) E422G probably benign Het
Ralyl A G 3: 14,208,472 (GRCm39) E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,558,962 (GRCm39) probably benign Het
Rit1 C G 3: 88,636,477 (GRCm39) T127S probably damaging Het
Slc16a7 C T 10: 125,067,067 (GRCm39) V191M probably damaging Het
Slc34a2 A T 5: 53,215,778 (GRCm39) H63L probably benign Het
Smpd4 G A 16: 17,460,166 (GRCm39) probably null Het
Sp3 A G 2: 72,768,520 (GRCm39) S748P possibly damaging Het
Spata31d1b G A 13: 59,863,671 (GRCm39) C273Y probably benign Het
Spata31d1b G A 13: 59,865,279 (GRCm39) R809K probably benign Het
Tmco5 A T 2: 116,711,360 (GRCm39) E90V probably damaging Het
Tnxb A T 17: 34,897,884 (GRCm39) D844V probably damaging Het
Tpi1 T C 6: 124,791,115 (GRCm39) T41A probably benign Het
Ttn T C 2: 76,557,536 (GRCm39) I29853V probably damaging Het
Vmn2r26 C T 6: 124,001,730 (GRCm39) T5I probably benign Het
Wdr95 A G 5: 149,522,831 (GRCm39) D663G probably benign Het
Zbtb39 T C 10: 127,578,569 (GRCm39) F381S probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp646 T A 7: 127,478,911 (GRCm39) Y363N probably damaging Het
Zfp712 A C 13: 67,190,111 (GRCm39) C139G probably damaging Het
Zfp958 A G 8: 4,678,590 (GRCm39) H205R probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68,859,569 (GRCm39) missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68,886,877 (GRCm39) missense probably benign 0.00
IGL01021:Adam28 APN 14 68,879,563 (GRCm39) missense probably benign
IGL01099:Adam28 APN 14 68,874,778 (GRCm39) critical splice donor site probably null
IGL01349:Adam28 APN 14 68,848,455 (GRCm39) missense probably benign 0.01
IGL01744:Adam28 APN 14 68,844,956 (GRCm39) missense probably benign 0.07
IGL01805:Adam28 APN 14 68,879,540 (GRCm39) missense probably benign 0.09
IGL02007:Adam28 APN 14 68,870,668 (GRCm39) missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68,884,319 (GRCm39) missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68,874,883 (GRCm39) missense probably damaging 1.00
IGL03355:Adam28 APN 14 68,872,252 (GRCm39) splice site probably benign
IGL02980:Adam28 UTSW 14 68,857,255 (GRCm39) missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68,872,325 (GRCm39) missense probably benign 0.00
R0184:Adam28 UTSW 14 68,874,822 (GRCm39) missense probably benign 0.33
R0321:Adam28 UTSW 14 68,855,200 (GRCm39) missense probably damaging 0.97
R0329:Adam28 UTSW 14 68,855,188 (GRCm39) missense probably damaging 0.96
R0494:Adam28 UTSW 14 68,868,241 (GRCm39) splice site probably benign
R0605:Adam28 UTSW 14 68,844,049 (GRCm39) unclassified probably benign
R0732:Adam28 UTSW 14 68,874,796 (GRCm39) missense probably benign 0.00
R0959:Adam28 UTSW 14 68,845,387 (GRCm39) missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68,846,578 (GRCm39) missense probably benign 0.28
R1745:Adam28 UTSW 14 68,870,620 (GRCm39) missense probably benign 0.04
R1836:Adam28 UTSW 14 68,886,870 (GRCm39) missense possibly damaging 0.85
R1839:Adam28 UTSW 14 68,876,659 (GRCm39) missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68,876,644 (GRCm39) missense probably benign 0.01
R1912:Adam28 UTSW 14 68,881,780 (GRCm39) missense probably benign 0.24
R2830:Adam28 UTSW 14 68,864,363 (GRCm39) missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68,872,294 (GRCm39) missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R3978:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R3979:Adam28 UTSW 14 68,848,443 (GRCm39) missense probably benign 0.20
R4282:Adam28 UTSW 14 68,885,155 (GRCm39) missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68,859,531 (GRCm39) critical splice donor site probably null
R4690:Adam28 UTSW 14 68,879,497 (GRCm39) missense probably benign 0.01
R4724:Adam28 UTSW 14 68,864,326 (GRCm39) missense probably damaging 0.99
R4768:Adam28 UTSW 14 68,872,264 (GRCm39) missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68,875,552 (GRCm39) missense probably damaging 0.99
R5054:Adam28 UTSW 14 68,855,164 (GRCm39) missense probably damaging 1.00
R5710:Adam28 UTSW 14 68,847,357 (GRCm39) missense probably damaging 0.96
R5835:Adam28 UTSW 14 68,893,130 (GRCm39) missense possibly damaging 0.96
R6002:Adam28 UTSW 14 68,879,511 (GRCm39) missense probably benign
R6054:Adam28 UTSW 14 68,879,601 (GRCm39) missense probably benign 0.01
R6349:Adam28 UTSW 14 68,870,621 (GRCm39) missense probably benign 0.29
R6449:Adam28 UTSW 14 68,868,116 (GRCm39) missense probably benign 0.31
R6455:Adam28 UTSW 14 68,870,657 (GRCm39) missense probably damaging 1.00
R6831:Adam28 UTSW 14 68,855,576 (GRCm39) missense probably benign 0.04
R6833:Adam28 UTSW 14 68,855,576 (GRCm39) missense probably benign 0.04
R7212:Adam28 UTSW 14 68,874,846 (GRCm39) missense probably damaging 0.99
R7411:Adam28 UTSW 14 68,864,396 (GRCm39) missense probably damaging 1.00
R7422:Adam28 UTSW 14 68,864,326 (GRCm39) missense probably damaging 1.00
R7516:Adam28 UTSW 14 68,868,125 (GRCm39) missense probably damaging 1.00
R7649:Adam28 UTSW 14 68,872,282 (GRCm39) missense probably benign 0.12
R7765:Adam28 UTSW 14 68,846,555 (GRCm39) critical splice donor site probably null
R8469:Adam28 UTSW 14 68,844,029 (GRCm39) missense probably benign 0.16
R8520:Adam28 UTSW 14 68,879,532 (GRCm39) missense probably damaging 0.98
R9026:Adam28 UTSW 14 68,846,593 (GRCm39) missense probably benign 0.16
R9163:Adam28 UTSW 14 68,866,531 (GRCm39) missense probably damaging 0.98
R9264:Adam28 UTSW 14 68,844,914 (GRCm39) missense probably benign
R9304:Adam28 UTSW 14 68,874,946 (GRCm39) missense probably damaging 1.00
R9357:Adam28 UTSW 14 68,879,479 (GRCm39) missense probably benign 0.36
R9441:Adam28 UTSW 14 68,874,943 (GRCm39) missense probably damaging 0.96
Z1177:Adam28 UTSW 14 68,864,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAAGGGTTGCCTTTCTC -3'
(R):5'- GCCTTGTCTGTACACATGCC -3'

Sequencing Primer
(F):5'- AGGGTTGCCTTTCTCCAAAAAGC -3'
(R):5'- TCTGTACACATGCCGGGGTG -3'
Posted On 2014-06-23