Incidental Mutation 'R1838:Smpd4'
ID 205545
Institutional Source Beutler Lab
Gene Symbol Smpd4
Ensembl Gene ENSMUSG00000005899
Gene Name sphingomyelin phosphodiesterase 4
Synonyms 4122402O22Rik, neutral membrane (neutral sphingomyelinase-3)
MMRRC Submission 039865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R1838 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 17437218-17462692 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 17460166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006053] [ENSMUST00000056962] [ENSMUST00000090159] [ENSMUST00000163476] [ENSMUST00000163997] [ENSMUST00000163997] [ENSMUST00000165363] [ENSMUST00000170117] [ENSMUST00000170273] [ENSMUST00000170273] [ENSMUST00000170996] [ENSMUST00000170996] [ENSMUST00000182117] [ENSMUST00000182344] [ENSMUST00000182368] [ENSMUST00000232116] [ENSMUST00000231627] [ENSMUST00000232271] [ENSMUST00000231722] [ENSMUST00000232021] [ENSMUST00000231436] [ENSMUST00000231792]
AlphaFold Q6ZPR5
Predicted Effect probably null
Transcript: ENSMUST00000006053
SMART Domains Protein: ENSMUSP00000006053
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 768 N/A PFAM
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056962
SMART Domains Protein: ENSMUSP00000049541
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 50 105 4.1e-24 PFAM
low complexity region 154 164 N/A INTRINSIC
Pfam:CCDC74_C 209 326 1.4e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000090159
SMART Domains Protein: ENSMUSP00000087620
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.4e-177 PFAM
Pfam:mit_SMPDase 287 752 9.4e-259 PFAM
transmembrane domain 753 775 N/A INTRINSIC
transmembrane domain 782 799 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163476
SMART Domains Protein: ENSMUSP00000131867
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 739 9.8e-266 PFAM
transmembrane domain 740 762 N/A INTRINSIC
transmembrane domain 769 786 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163997
SMART Domains Protein: ENSMUSP00000128595
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.1e-17 PFAM
Pfam:mit_SMPDase 42 68 2.5e-13 PFAM
Pfam:mit_SMPDase 65 518 4.9e-266 PFAM
transmembrane domain 519 541 N/A INTRINSIC
transmembrane domain 548 565 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163997
SMART Domains Protein: ENSMUSP00000128595
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.1e-17 PFAM
Pfam:mit_SMPDase 42 68 2.5e-13 PFAM
Pfam:mit_SMPDase 65 518 4.9e-266 PFAM
transmembrane domain 519 541 N/A INTRINSIC
transmembrane domain 548 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164292
Predicted Effect probably null
Transcript: ENSMUST00000165363
SMART Domains Protein: ENSMUSP00000130720
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 738 4.1e-262 PFAM
transmembrane domain 739 761 N/A INTRINSIC
transmembrane domain 768 785 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000132279
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 46 2.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170273
SMART Domains Protein: ENSMUSP00000129957
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.6e-17 PFAM
Pfam:mit_SMPDase 41 215 4.1e-103 PFAM
Pfam:mit_SMPDase 214 666 1.3e-265 PFAM
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170273
SMART Domains Protein: ENSMUSP00000129957
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.6e-17 PFAM
Pfam:mit_SMPDase 41 215 4.1e-103 PFAM
Pfam:mit_SMPDase 214 666 1.3e-265 PFAM
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170996
SMART Domains Protein: ENSMUSP00000129074
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 26 444 4.4e-234 PFAM
transmembrane domain 445 467 N/A INTRINSIC
transmembrane domain 474 491 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170996
SMART Domains Protein: ENSMUSP00000129074
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 26 444 4.4e-234 PFAM
transmembrane domain 445 467 N/A INTRINSIC
transmembrane domain 474 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167362
Predicted Effect probably benign
Transcript: ENSMUST00000182117
SMART Domains Protein: ENSMUSP00000138657
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Pfam:CCDC92 36 97 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182344
SMART Domains Protein: ENSMUSP00000138131
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
Pfam:CCDC92 18 79 1.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182368
SMART Domains Protein: ENSMUSP00000138262
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 49 110 2.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183101
Predicted Effect probably benign
Transcript: ENSMUST00000182976
Predicted Effect probably benign
Transcript: ENSMUST00000232116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232270
Predicted Effect probably benign
Transcript: ENSMUST00000231627
Predicted Effect probably null
Transcript: ENSMUST00000232271
Predicted Effect probably benign
Transcript: ENSMUST00000231722
Predicted Effect probably null
Transcript: ENSMUST00000232021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231378
Predicted Effect probably benign
Transcript: ENSMUST00000231436
Predicted Effect probably null
Transcript: ENSMUST00000231792
Predicted Effect probably benign
Transcript: ENSMUST00000182671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232468
Predicted Effect probably benign
Transcript: ENSMUST00000183279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232417
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sphingomyelinases (EC 3.1.4.12), such as SMPD4, catalyze the hydrolysis of membrane sphingomyelin to form phosphorylcholine and ceramide (Krut et al., 2006 [PubMed 16517606]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,603,690 (GRCm39) D22G unknown Het
Abca4 G A 3: 121,921,954 (GRCm39) R1170K probably benign Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adamtsl3 G T 7: 82,142,581 (GRCm39) R267L probably damaging Het
Adgrb2 A T 4: 129,904,024 (GRCm39) T717S probably benign Het
Adgrb3 A G 1: 25,123,351 (GRCm39) S1417P probably damaging Het
Afg3l2 A T 18: 67,547,242 (GRCm39) V561D probably damaging Het
Atp13a2 T A 4: 140,721,643 (GRCm39) Y244* probably null Het
BB014433 C G 8: 15,092,629 (GRCm39) V75L unknown Het
Btnl6 T A 17: 34,734,516 (GRCm39) D82V probably damaging Het
Ccdc178 A G 18: 22,200,695 (GRCm39) Y421H probably damaging Het
Cdc123 A T 2: 5,799,702 (GRCm39) probably null Het
Cdhr5 C T 7: 140,852,516 (GRCm39) V367I possibly damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Ctnna2 T C 6: 77,822,525 (GRCm39) D26G probably damaging Het
Ctr9 G T 7: 110,651,510 (GRCm39) R910L possibly damaging Het
Cyp2t4 G T 7: 26,857,841 (GRCm39) R455L possibly damaging Het
Cyp3a13 A T 5: 137,909,894 (GRCm39) probably null Het
Dennd3 T C 15: 73,436,949 (GRCm39) S1059P probably damaging Het
Dennd4c A G 4: 86,743,415 (GRCm39) T1135A probably benign Het
Dnah7b T C 1: 46,155,337 (GRCm39) V295A probably benign Het
Dnah7b C A 1: 46,316,265 (GRCm39) T3126K probably damaging Het
Ehbp1l1 C T 19: 5,767,719 (GRCm39) E1195K probably benign Het
Exoc6b T A 6: 84,830,660 (GRCm39) I447L probably benign Het
Glt1d1 G A 5: 127,755,193 (GRCm39) V202I probably benign Het
Grk1 T C 8: 13,466,155 (GRCm39) V533A possibly damaging Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Gzma T A 13: 113,232,518 (GRCm39) I131F probably damaging Het
Helq A T 5: 100,919,745 (GRCm39) L35* probably null Het
Hnrnpll T C 17: 80,346,052 (GRCm39) N403S probably damaging Het
Hsf5 A G 11: 87,526,881 (GRCm39) K518E probably benign Het
Ighe T A 12: 113,235,470 (GRCm39) H258L unknown Het
Il6ra T C 3: 89,797,579 (GRCm39) D96G probably benign Het
Ints13 C T 6: 146,468,109 (GRCm39) A129T possibly damaging Het
Ipo7 T A 7: 109,641,316 (GRCm39) H345Q probably damaging Het
Kcna2 A T 3: 107,011,828 (GRCm39) E136D probably benign Het
Kif5a G A 10: 127,072,684 (GRCm39) Q702* probably null Het
Klhdc7a G T 4: 139,694,381 (GRCm39) P189T probably benign Het
Krtap4-9 A G 11: 99,676,222 (GRCm39) probably benign Het
Lamc3 T C 2: 31,815,594 (GRCm39) S1097P possibly damaging Het
Ldlrad2 A T 4: 137,299,481 (GRCm39) N114K probably benign Het
Lrfn1 A T 7: 28,159,193 (GRCm39) I371L probably damaging Het
Lrwd1 A G 5: 136,161,242 (GRCm39) V240A probably benign Het
Lypd1 A T 1: 125,801,108 (GRCm39) probably benign Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Man2c1 A G 9: 57,044,621 (GRCm39) N354S probably benign Het
Map3k13 T C 16: 21,732,939 (GRCm39) Y514H possibly damaging Het
Med15 T C 16: 17,471,426 (GRCm39) D577G probably benign Het
Mroh4 A T 15: 74,487,962 (GRCm39) M320K probably benign Het
Ms4a10 T A 19: 10,941,411 (GRCm39) D186V possibly damaging Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Myo5c A T 9: 75,180,835 (GRCm39) R741S probably damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Naip6 T C 13: 100,452,644 (GRCm39) D139G probably damaging Het
Or10s1 A T 9: 39,985,605 (GRCm39) M5L probably benign Het
Or2p2 A T 13: 21,256,595 (GRCm39) L292* probably null Het
Or4a79 A T 2: 89,552,053 (GRCm39) M134K probably damaging Het
Or8g2 A T 9: 39,821,137 (GRCm39) I13F possibly damaging Het
Pcdhb3 A G 18: 37,434,370 (GRCm39) D112G probably benign Het
Pdpr C A 8: 111,861,366 (GRCm39) P787T probably damaging Het
Pgm3 C T 9: 86,451,286 (GRCm39) V123I probably benign Het
Pms1 A C 1: 53,231,257 (GRCm39) probably null Het
Prl2b1 A G 13: 27,572,549 (GRCm39) S14P possibly damaging Het
Prune2 T A 19: 17,177,242 (GRCm39) W212R probably damaging Het
Rabgef1 A G 5: 130,241,862 (GRCm39) E422G probably benign Het
Ralyl A G 3: 14,208,472 (GRCm39) E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,558,962 (GRCm39) probably benign Het
Rit1 C G 3: 88,636,477 (GRCm39) T127S probably damaging Het
Slc16a7 C T 10: 125,067,067 (GRCm39) V191M probably damaging Het
Slc34a2 A T 5: 53,215,778 (GRCm39) H63L probably benign Het
Sp3 A G 2: 72,768,520 (GRCm39) S748P possibly damaging Het
Spata31d1b G A 13: 59,863,671 (GRCm39) C273Y probably benign Het
Spata31d1b G A 13: 59,865,279 (GRCm39) R809K probably benign Het
Tmco5 A T 2: 116,711,360 (GRCm39) E90V probably damaging Het
Tnxb A T 17: 34,897,884 (GRCm39) D844V probably damaging Het
Tpi1 T C 6: 124,791,115 (GRCm39) T41A probably benign Het
Ttn T C 2: 76,557,536 (GRCm39) I29853V probably damaging Het
Vmn2r26 C T 6: 124,001,730 (GRCm39) T5I probably benign Het
Wdr95 A G 5: 149,522,831 (GRCm39) D663G probably benign Het
Zbtb39 T C 10: 127,578,569 (GRCm39) F381S probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp646 T A 7: 127,478,911 (GRCm39) Y363N probably damaging Het
Zfp712 A C 13: 67,190,111 (GRCm39) C139G probably damaging Het
Zfp958 A G 8: 4,678,590 (GRCm39) H205R probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Smpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Smpd4 APN 16 17,460,621 (GRCm39) missense probably benign 0.04
IGL01461:Smpd4 APN 16 17,439,370 (GRCm39) missense probably damaging 1.00
IGL02051:Smpd4 APN 16 17,444,382 (GRCm39) missense probably damaging 1.00
IGL02492:Smpd4 APN 16 17,457,215 (GRCm39) missense probably damaging 1.00
IGL03181:Smpd4 APN 16 17,443,671 (GRCm39) nonsense probably null
Victim UTSW 16 17,458,835 (GRCm39) missense probably damaging 1.00
weakling UTSW 16 17,456,350 (GRCm39) intron probably benign
G1citation:Smpd4 UTSW 16 17,458,097 (GRCm39) missense probably damaging 1.00
R0197:Smpd4 UTSW 16 17,459,461 (GRCm39) critical splice donor site probably null
R0549:Smpd4 UTSW 16 17,457,176 (GRCm39) missense probably benign 0.15
R0789:Smpd4 UTSW 16 17,443,690 (GRCm39) missense probably benign 0.14
R1077:Smpd4 UTSW 16 17,441,833 (GRCm39) missense probably damaging 1.00
R1120:Smpd4 UTSW 16 17,456,350 (GRCm39) intron probably benign
R1716:Smpd4 UTSW 16 17,460,365 (GRCm39) missense probably damaging 1.00
R1758:Smpd4 UTSW 16 17,458,744 (GRCm39) missense probably damaging 1.00
R1758:Smpd4 UTSW 16 17,443,872 (GRCm39) missense probably damaging 0.99
R2115:Smpd4 UTSW 16 17,444,729 (GRCm39) missense probably benign 0.33
R2849:Smpd4 UTSW 16 17,460,076 (GRCm39) missense probably damaging 1.00
R4654:Smpd4 UTSW 16 17,459,992 (GRCm39) intron probably benign
R6157:Smpd4 UTSW 16 17,458,930 (GRCm39) splice site probably null
R6190:Smpd4 UTSW 16 17,449,877 (GRCm39) missense probably damaging 1.00
R6822:Smpd4 UTSW 16 17,458,097 (GRCm39) missense probably damaging 1.00
R7062:Smpd4 UTSW 16 17,458,835 (GRCm39) missense probably damaging 1.00
R7305:Smpd4 UTSW 16 17,459,647 (GRCm39) missense probably damaging 0.99
R7759:Smpd4 UTSW 16 17,456,497 (GRCm39) missense probably damaging 1.00
R7853:Smpd4 UTSW 16 17,460,605 (GRCm39) missense probably damaging 1.00
R8187:Smpd4 UTSW 16 17,446,999 (GRCm39) missense probably damaging 1.00
R8303:Smpd4 UTSW 16 17,457,195 (GRCm39) missense probably damaging 1.00
R8518:Smpd4 UTSW 16 17,458,884 (GRCm39) missense possibly damaging 0.89
R8735:Smpd4 UTSW 16 17,453,410 (GRCm39) missense possibly damaging 0.92
R9075:Smpd4 UTSW 16 17,457,849 (GRCm39) missense unknown
R9439:Smpd4 UTSW 16 17,459,451 (GRCm39) missense probably benign
Z1176:Smpd4 UTSW 16 17,437,450 (GRCm39) intron probably benign
Z1177:Smpd4 UTSW 16 17,439,305 (GRCm39) critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GTTCACGGAAACATTTTGCTTG -3'
(R):5'- ATCTGGCCTGCAAACTAGAG -3'

Sequencing Primer
(F):5'- CGGAAACATTTTGCTTGCATTAATG -3'
(R):5'- GAACAAACAAGGACTCAGCAGTTG -3'
Posted On 2014-06-23