Mutagenetix > Incidental Mutations

Incidental Mutation 'R1838:Hnrnpll'

205554

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpll

Ensembl Gene

ENSMUSG00000024095

Gene Name

heterogeneous nuclear ribonucleoprotein L-like

Synonyms

2510028H02Rik, Hnrpll, 2810036L13Rik

MMRRC Submission

039865-MU

Accession Numbers

Genbank: NM_144802; MGI: 1919942

Is this an essential gene?

Probably essential (E-score: 0.776) question?

Stock #

R1838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80029487-80062334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80038623 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 403 (N403S)

Ref Sequence

ENSEMBL: ENSMUSP00000139372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]

Predicted Effect

probably damaging
Transcript: ENSMUST00000061331
AA Change: N403S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: N403S

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183516

Predicted Effect

probably benign
Transcript: ENSMUST00000184297

SMART Domains

Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184578

Predicted Effect

probably damaging
Transcript: ENSMUST00000184635
AA Change: N403S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: N403S

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4⁺ T cell counts are lower, with a reduction of naï¿½ve CD44^lo T cells occurring as mice age. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	T	C	6: 132,626,727	D22G	unknown	Het
Abca4	G	A	3: 122,128,305	R1170K	probably benign	Het
Adam28	T	C	14: 68,639,210	N197S	possibly damaging	Het
Adamtsl3	G	T	7: 82,493,373	R267L	probably damaging	Het
Adgrb2	A	T	4: 130,010,231	T717S	probably benign	Het
Adgrb3	A	G	1: 25,084,270	S1417P	probably damaging	Het
Afg3l2	A	T	18: 67,414,172	V561D	probably damaging	Het
Atp13a2	T	A	4: 140,994,332	Y244*	probably null	Het
BB014433	C	G	8: 15,042,629	V75L	unknown	Het
Btnl6	T	A	17: 34,515,542	D82V	probably damaging	Het
Ccdc178	A	G	18: 22,067,638	Y421H	probably damaging	Het
Cdc123	A	T	2: 5,794,891		probably null	Het
Cdhr5	C	T	7: 141,272,603	V367I	possibly damaging	Het
Celsr3	A	G	9: 108,829,906	H1196R	probably benign	Het
Chd8	T	C	14: 52,204,883	S2077G	probably benign	Het
Col6a5	G	A	9: 105,864,833	H2296Y	probably benign	Het
Ctnna2	T	C	6: 77,845,542	D26G	probably damaging	Het
Ctr9	G	T	7: 111,052,303	R910L	possibly damaging	Het
Cyp2t4	G	T	7: 27,158,416	R455L	possibly damaging	Het
Cyp3a13	A	T	5: 137,911,632		probably null	Het
Dennd3	T	C	15: 73,565,100	S1059P	probably damaging	Het
Dennd4c	A	G	4: 86,825,178	T1135A	probably benign	Het
Dnah7b	T	C	1: 46,116,177	V295A	probably benign	Het
Dnah7b	C	A	1: 46,277,105	T3126K	probably damaging	Het
Ehbp1l1	C	T	19: 5,717,691	E1195K	probably benign	Het
Exoc6b	T	A	6: 84,853,678	I447L	probably benign	Het
Glt1d1	G	A	5: 127,678,129	V202I	probably benign	Het
Grk1	T	C	8: 13,416,155	V533A	possibly damaging	Het
Gsdma3	C	T	11: 98,629,858	A105V	probably benign	Het
Gzma	T	A	13: 113,095,984	I131F	probably damaging	Het
Helq	A	T	5: 100,771,879	L35*	probably null	Het
Hsf5	A	G	11: 87,636,055	K518E	probably benign	Het
Ighe	T	A	12: 113,271,850	H258L	unknown	Het
Il6ra	T	C	3: 89,890,272	D96G	probably benign	Het
Ints13	C	T	6: 146,566,611	A129T	possibly damaging	Het
Ipo7	T	A	7: 110,042,109	H345Q	probably damaging	Het
Kcna2	A	T	3: 107,104,512	E136D	probably benign	Het
Kif5a	G	A	10: 127,236,815	Q702*	probably null	Het
Klhdc7a	G	T	4: 139,967,070	P189T	probably benign	Het
Krtap4-9	A	G	11: 99,785,396		probably benign	Het
Lamc3	T	C	2: 31,925,582	S1097P	possibly damaging	Het
Ldlrad2	A	T	4: 137,572,170	N114K	probably benign	Het
Lrfn1	A	T	7: 28,459,768	I371L	probably damaging	Het
Lrwd1	A	G	5: 136,132,388	V240A	probably benign	Het
Lypd1	A	T	1: 125,873,371		probably benign	Het
Magi2	A	T	5: 20,465,827	T163S	probably damaging	Het
Man2c1	A	G	9: 57,137,337	N354S	probably benign	Het
Map3k13	T	C	16: 21,914,189	Y514H	possibly damaging	Het
Med15	T	C	16: 17,653,562	D577G	probably benign	Het
Mroh4	A	T	15: 74,616,113	M320K	probably benign	Het
Ms4a10	T	A	19: 10,964,047	D186V	possibly damaging	Het
Myh7	T	C	14: 54,973,180	N1725S	possibly damaging	Het
Myo5c	A	T	9: 75,273,553	R741S	probably damaging	Het
Naip6	T	C	13: 100,316,136	D139G	probably damaging	Het
Nat6	G	A	9: 107,583,017	R37H	possibly damaging	Het
Olfr1252	A	T	2: 89,721,709	M134K	probably damaging	Het
Olfr1370	A	T	13: 21,072,425	L292*	probably null	Het
Olfr229	A	T	9: 39,909,841	I13F	possibly damaging	Het
Olfr982	A	T	9: 40,074,309	M5L	probably benign	Het
Pcdhb3	A	G	18: 37,301,317	D112G	probably benign	Het
Pdpr	C	A	8: 111,134,734	P787T	probably damaging	Het
Pgm3	C	T	9: 86,569,233	V123I	probably benign	Het
Pms1	A	C	1: 53,192,098		probably null	Het
Prl2b1	A	G	13: 27,388,566	S14P	possibly damaging	Het
Prune2	T	A	19: 17,199,878	W212R	probably damaging	Het
Rabgef1	A	G	5: 130,213,021	E422G	probably benign	Het
Ralyl	A	G	3: 14,143,412	E204G	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rbpms2	TGCCGCCGCC	TGCCGCCGCCGCC	9: 65,651,680		probably benign	Het
Rit1	C	G	3: 88,729,170	T127S	probably damaging	Het
Slc16a7	C	T	10: 125,231,198	V191M	probably damaging	Het
Slc34a2	A	T	5: 53,058,436	H63L	probably benign	Het
Smpd4	G	A	16: 17,642,302		probably null	Het
Sp3	A	G	2: 72,938,176	S748P	possibly damaging	Het
Spata31d1b	G	A	13: 59,715,857	C273Y	probably benign	Het
Spata31d1b	G	A	13: 59,717,465	R809K	probably benign	Het
Tmco5	A	T	2: 116,880,879	E90V	probably damaging	Het
Tnxb	A	T	17: 34,678,910	D844V	probably damaging	Het
Tpi1	T	C	6: 124,814,152	T41A	probably benign	Het
Ttn	T	C	2: 76,727,192	I29853V	probably damaging	Het
Vmn2r26	C	T	6: 124,024,771	T5I	probably benign	Het
Wdr95	A	G	5: 149,599,366	D663G	probably benign	Het
Zbtb39	T	C	10: 127,742,700	F381S	probably damaging	Het
Zfp523	T	A	17: 28,194,993	I34N	probably damaging	Het
Zfp646	T	A	7: 127,879,739	Y363N	probably damaging	Het
Zfp712	A	C	13: 67,042,047	C139G	probably damaging	Het
Zfp958	A	G	8: 4,628,590	H205R	probably damaging	Het
Zfp974	G	A	7: 27,910,356	P648L	possibly damaging	Het

Other mutations in Hnrnpll

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
thunder	APN	17	80053571	missense	probably damaging	1.00
IGL01989:Hnrnpll	APN	17	80038740	missense	probably benign	0.15
IGL02093:Hnrnpll	APN	17	80044504	missense	probably benign	0.00
IGL02141:Hnrnpll	APN	17	80050713	missense	probably benign	0.02
IGL02749:Hnrnpll	APN	17	80061991	start codon destroyed	probably null
IGL03213:Hnrnpll	APN	17	80034098	missense	probably damaging	1.00
Grell	UTSW	17	80034105	missense	probably damaging	1.00
Lindsley	UTSW	17	80049847	missense	probably damaging	1.00
R0477:Hnrnpll	UTSW	17	80061832	missense	unknown
R1599:Hnrnpll	UTSW	17	80053625	missense	unknown
R1700:Hnrnpll	UTSW	17	80034105	missense	probably benign	0.18
R1907:Hnrnpll	UTSW	17	80035329	critical splice donor site	probably null
R1978:Hnrnpll	UTSW	17	80044518	missense	probably benign	0.01
R2079:Hnrnpll	UTSW	17	80035377	missense	probably benign	0.01
R4061:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4062:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4064:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4226:Hnrnpll	UTSW	17	80049805	critical splice donor site	probably null
R4625:Hnrnpll	UTSW	17	80050862	nonsense	probably null
R5175:Hnrnpll	UTSW	17	80034070	missense	possibly damaging	0.83
R5232:Hnrnpll	UTSW	17	80038678	missense	probably damaging	1.00
R5620:Hnrnpll	UTSW	17	80038622	missense	probably damaging	1.00
R5978:Hnrnpll	UTSW	17	80034191	missense	probably damaging	1.00
R6183:Hnrnpll	UTSW	17	80049876	missense	possibly damaging	0.46
R6374:Hnrnpll	UTSW	17	80049874	missense	possibly damaging	0.51
R7120:Hnrnpll	UTSW	17	80034057	missense	probably benign	0.01
R7429:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7430:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7576:Hnrnpll	UTSW	17	80044514	missense	possibly damaging	0.91
R8001:Hnrnpll	UTSW	17	80038723	nonsense	probably null
R8010:Hnrnpll	UTSW	17	80061956	missense	unknown
R8060:Hnrnpll	UTSW	17	80034105	missense	probably damaging	1.00
R8068:Hnrnpll	UTSW	17	80050852	missense	possibly damaging	0.80
R8381:Hnrnpll	UTSW	17	80030491	missense	probably damaging	1.00
Z1177:Hnrnpll	UTSW	17	80048610	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAAATTGCTGCTTTGGACCTTG -3'
(R):5'- GCTACTGCCTTTACCAAGTCG -3'

Sequencing Primer
(F):5'- TGGACCTTGCTCTTTATACTGG -3'
(R):5'- CCAAGTCGTTATAGAATGGGCTC -3'

Posted On

2014-06-23