Incidental Mutation 'R1838:Hnrnpll'
ID 205554
Institutional Source Beutler Lab
Gene Symbol Hnrnpll
Ensembl Gene ENSMUSG00000024095
Gene Name heterogeneous nuclear ribonucleoprotein L-like
Synonyms 2510028H02Rik, Hnrpll, 2810036L13Rik
MMRRC Submission 039865-MU
Accession Numbers

Genbank: NM_144802; MGI: 1919942
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock # R1838 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 80029487-80062334 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80038623 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 403 (N403S)
Ref Sequence ENSEMBL: ENSMUSP00000139372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]
AlphaFold Q921F4
Predicted Effect probably damaging
Transcript: ENSMUST00000061331
AA Change: N403S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: N403S

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183516
Predicted Effect probably benign
Transcript: ENSMUST00000184297
SMART Domains Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184578
Predicted Effect probably damaging
Transcript: ENSMUST00000184635
AA Change: N403S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: N403S

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4+ T cell counts are lower, with a reduction of na�ve CD44lo T cells occurring as mice age. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,727 D22G unknown Het
Abca4 G A 3: 122,128,305 R1170K probably benign Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adamtsl3 G T 7: 82,493,373 R267L probably damaging Het
Adgrb2 A T 4: 130,010,231 T717S probably benign Het
Adgrb3 A G 1: 25,084,270 S1417P probably damaging Het
Afg3l2 A T 18: 67,414,172 V561D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Btnl6 T A 17: 34,515,542 D82V probably damaging Het
Ccdc178 A G 18: 22,067,638 Y421H probably damaging Het
Cdc123 A T 2: 5,794,891 probably null Het
Cdhr5 C T 7: 141,272,603 V367I possibly damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Ctnna2 T C 6: 77,845,542 D26G probably damaging Het
Ctr9 G T 7: 111,052,303 R910L possibly damaging Het
Cyp2t4 G T 7: 27,158,416 R455L possibly damaging Het
Cyp3a13 A T 5: 137,911,632 probably null Het
Dennd3 T C 15: 73,565,100 S1059P probably damaging Het
Dennd4c A G 4: 86,825,178 T1135A probably benign Het
Dnah7b T C 1: 46,116,177 V295A probably benign Het
Dnah7b C A 1: 46,277,105 T3126K probably damaging Het
Ehbp1l1 C T 19: 5,717,691 E1195K probably benign Het
Exoc6b T A 6: 84,853,678 I447L probably benign Het
Glt1d1 G A 5: 127,678,129 V202I probably benign Het
Grk1 T C 8: 13,416,155 V533A possibly damaging Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Gzma T A 13: 113,095,984 I131F probably damaging Het
Helq A T 5: 100,771,879 L35* probably null Het
Hsf5 A G 11: 87,636,055 K518E probably benign Het
Ighe T A 12: 113,271,850 H258L unknown Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Ints13 C T 6: 146,566,611 A129T possibly damaging Het
Ipo7 T A 7: 110,042,109 H345Q probably damaging Het
Kcna2 A T 3: 107,104,512 E136D probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krtap4-9 A G 11: 99,785,396 probably benign Het
Lamc3 T C 2: 31,925,582 S1097P possibly damaging Het
Ldlrad2 A T 4: 137,572,170 N114K probably benign Het
Lrfn1 A T 7: 28,459,768 I371L probably damaging Het
Lrwd1 A G 5: 136,132,388 V240A probably benign Het
Lypd1 A T 1: 125,873,371 probably benign Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Man2c1 A G 9: 57,137,337 N354S probably benign Het
Map3k13 T C 16: 21,914,189 Y514H possibly damaging Het
Med15 T C 16: 17,653,562 D577G probably benign Het
Mroh4 A T 15: 74,616,113 M320K probably benign Het
Ms4a10 T A 19: 10,964,047 D186V possibly damaging Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Myo5c A T 9: 75,273,553 R741S probably damaging Het
Naip6 T C 13: 100,316,136 D139G probably damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Olfr1252 A T 2: 89,721,709 M134K probably damaging Het
Olfr1370 A T 13: 21,072,425 L292* probably null Het
Olfr229 A T 9: 39,909,841 I13F possibly damaging Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Pcdhb3 A G 18: 37,301,317 D112G probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Pgm3 C T 9: 86,569,233 V123I probably benign Het
Pms1 A C 1: 53,192,098 probably null Het
Prl2b1 A G 13: 27,388,566 S14P possibly damaging Het
Prune2 T A 19: 17,199,878 W212R probably damaging Het
Rabgef1 A G 5: 130,213,021 E422G probably benign Het
Ralyl A G 3: 14,143,412 E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,651,680 probably benign Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Slc16a7 C T 10: 125,231,198 V191M probably damaging Het
Slc34a2 A T 5: 53,058,436 H63L probably benign Het
Smpd4 G A 16: 17,642,302 probably null Het
Sp3 A G 2: 72,938,176 S748P possibly damaging Het
Spata31d1b G A 13: 59,715,857 C273Y probably benign Het
Spata31d1b G A 13: 59,717,465 R809K probably benign Het
Tmco5 A T 2: 116,880,879 E90V probably damaging Het
Tnxb A T 17: 34,678,910 D844V probably damaging Het
Tpi1 T C 6: 124,814,152 T41A probably benign Het
Ttn T C 2: 76,727,192 I29853V probably damaging Het
Vmn2r26 C T 6: 124,024,771 T5I probably benign Het
Wdr95 A G 5: 149,599,366 D663G probably benign Het
Zbtb39 T C 10: 127,742,700 F381S probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp646 T A 7: 127,879,739 Y363N probably damaging Het
Zfp712 A C 13: 67,042,047 C139G probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Hnrnpll
AlleleSourceChrCoordTypePredicted EffectPPH Score
thunder APN 17 80053571 missense probably damaging 1.00
IGL01989:Hnrnpll APN 17 80038740 missense probably benign 0.15
IGL02093:Hnrnpll APN 17 80044504 missense probably benign 0.00
IGL02141:Hnrnpll APN 17 80050713 missense probably benign 0.02
IGL02749:Hnrnpll APN 17 80061991 start codon destroyed probably null
IGL03213:Hnrnpll APN 17 80034098 missense probably damaging 1.00
Grell UTSW 17 80034105 missense probably damaging 1.00
Lindsley UTSW 17 80049847 missense probably damaging 1.00
R0477:Hnrnpll UTSW 17 80061832 missense unknown
R1599:Hnrnpll UTSW 17 80053625 missense unknown
R1700:Hnrnpll UTSW 17 80034105 missense probably benign 0.18
R1907:Hnrnpll UTSW 17 80035329 critical splice donor site probably null
R1978:Hnrnpll UTSW 17 80044518 missense probably benign 0.01
R2079:Hnrnpll UTSW 17 80035377 missense probably benign 0.01
R4061:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4062:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4064:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4226:Hnrnpll UTSW 17 80049805 critical splice donor site probably null
R4625:Hnrnpll UTSW 17 80050862 nonsense probably null
R5175:Hnrnpll UTSW 17 80034070 missense possibly damaging 0.83
R5232:Hnrnpll UTSW 17 80038678 missense probably damaging 1.00
R5620:Hnrnpll UTSW 17 80038622 missense probably damaging 1.00
R5978:Hnrnpll UTSW 17 80034191 missense probably damaging 1.00
R6183:Hnrnpll UTSW 17 80049876 missense possibly damaging 0.46
R6374:Hnrnpll UTSW 17 80049874 missense possibly damaging 0.51
R7120:Hnrnpll UTSW 17 80034057 missense probably benign 0.01
R7429:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7430:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7576:Hnrnpll UTSW 17 80044514 missense possibly damaging 0.91
R8001:Hnrnpll UTSW 17 80038723 nonsense probably null
R8010:Hnrnpll UTSW 17 80061956 missense unknown
R8060:Hnrnpll UTSW 17 80034105 missense probably damaging 1.00
R8068:Hnrnpll UTSW 17 80050852 missense possibly damaging 0.80
R8381:Hnrnpll UTSW 17 80030491 missense probably damaging 1.00
R9378:Hnrnpll UTSW 17 80061862 missense unknown
R9488:Hnrnpll UTSW 17 80061956 missense unknown
Z1177:Hnrnpll UTSW 17 80048610 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAATTGCTGCTTTGGACCTTG -3'
(R):5'- GCTACTGCCTTTACCAAGTCG -3'

Sequencing Primer
(F):5'- TGGACCTTGCTCTTTATACTGG -3'
(R):5'- CCAAGTCGTTATAGAATGGGCTC -3'
Posted On 2014-06-23