Mutagenetix > Incidental Mutation

Incidental Mutation 'R1838:Afg3l2'

205557

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

039865-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 67414172 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 561 (V561D)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: V561D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: V561D

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	T	C	6: 132,626,727	D22G	unknown	Het
Abca4	G	A	3: 122,128,305	R1170K	probably benign	Het
Adam28	T	C	14: 68,639,210	N197S	possibly damaging	Het
Adamtsl3	G	T	7: 82,493,373	R267L	probably damaging	Het
Adgrb2	A	T	4: 130,010,231	T717S	probably benign	Het
Adgrb3	A	G	1: 25,084,270	S1417P	probably damaging	Het
Atp13a2	T	A	4: 140,994,332	Y244*	probably null	Het
BB014433	C	G	8: 15,042,629	V75L	unknown	Het
Btnl6	T	A	17: 34,515,542	D82V	probably damaging	Het
Ccdc178	A	G	18: 22,067,638	Y421H	probably damaging	Het
Cdc123	A	T	2: 5,794,891		probably null	Het
Cdhr5	C	T	7: 141,272,603	V367I	possibly damaging	Het
Celsr3	A	G	9: 108,829,906	H1196R	probably benign	Het
Chd8	T	C	14: 52,204,883	S2077G	probably benign	Het
Col6a5	G	A	9: 105,864,833	H2296Y	probably benign	Het
Ctnna2	T	C	6: 77,845,542	D26G	probably damaging	Het
Ctr9	G	T	7: 111,052,303	R910L	possibly damaging	Het
Cyp2t4	G	T	7: 27,158,416	R455L	possibly damaging	Het
Cyp3a13	A	T	5: 137,911,632		probably null	Het
Dennd3	T	C	15: 73,565,100	S1059P	probably damaging	Het
Dennd4c	A	G	4: 86,825,178	T1135A	probably benign	Het
Dnah7b	T	C	1: 46,116,177	V295A	probably benign	Het
Dnah7b	C	A	1: 46,277,105	T3126K	probably damaging	Het
Ehbp1l1	C	T	19: 5,717,691	E1195K	probably benign	Het
Exoc6b	T	A	6: 84,853,678	I447L	probably benign	Het
Glt1d1	G	A	5: 127,678,129	V202I	probably benign	Het
Grk1	T	C	8: 13,416,155	V533A	possibly damaging	Het
Gsdma3	C	T	11: 98,629,858	A105V	probably benign	Het
Gzma	T	A	13: 113,095,984	I131F	probably damaging	Het
Helq	A	T	5: 100,771,879	L35*	probably null	Het
Hnrnpll	T	C	17: 80,038,623	N403S	probably damaging	Het
Hsf5	A	G	11: 87,636,055	K518E	probably benign	Het
Ighe	T	A	12: 113,271,850	H258L	unknown	Het
Il6ra	T	C	3: 89,890,272	D96G	probably benign	Het
Ints13	C	T	6: 146,566,611	A129T	possibly damaging	Het
Ipo7	T	A	7: 110,042,109	H345Q	probably damaging	Het
Kcna2	A	T	3: 107,104,512	E136D	probably benign	Het
Kif5a	G	A	10: 127,236,815	Q702*	probably null	Het
Klhdc7a	G	T	4: 139,967,070	P189T	probably benign	Het
Krtap4-9	A	G	11: 99,785,396		probably benign	Het
Lamc3	T	C	2: 31,925,582	S1097P	possibly damaging	Het
Ldlrad2	A	T	4: 137,572,170	N114K	probably benign	Het
Lrfn1	A	T	7: 28,459,768	I371L	probably damaging	Het
Lrwd1	A	G	5: 136,132,388	V240A	probably benign	Het
Lypd1	A	T	1: 125,873,371		probably benign	Het
Magi2	A	T	5: 20,465,827	T163S	probably damaging	Het
Man2c1	A	G	9: 57,137,337	N354S	probably benign	Het
Map3k13	T	C	16: 21,914,189	Y514H	possibly damaging	Het
Med15	T	C	16: 17,653,562	D577G	probably benign	Het
Mroh4	A	T	15: 74,616,113	M320K	probably benign	Het
Ms4a10	T	A	19: 10,964,047	D186V	possibly damaging	Het
Myh7	T	C	14: 54,973,180	N1725S	possibly damaging	Het
Myo5c	A	T	9: 75,273,553	R741S	probably damaging	Het
Naip6	T	C	13: 100,316,136	D139G	probably damaging	Het
Nat6	G	A	9: 107,583,017	R37H	possibly damaging	Het
Olfr1252	A	T	2: 89,721,709	M134K	probably damaging	Het
Olfr1370	A	T	13: 21,072,425	L292*	probably null	Het
Olfr229	A	T	9: 39,909,841	I13F	possibly damaging	Het
Olfr982	A	T	9: 40,074,309	M5L	probably benign	Het
Pcdhb3	A	G	18: 37,301,317	D112G	probably benign	Het
Pdpr	C	A	8: 111,134,734	P787T	probably damaging	Het
Pgm3	C	T	9: 86,569,233	V123I	probably benign	Het
Pms1	A	C	1: 53,192,098		probably null	Het
Prl2b1	A	G	13: 27,388,566	S14P	possibly damaging	Het
Prune2	T	A	19: 17,199,878	W212R	probably damaging	Het
Rabgef1	A	G	5: 130,213,021	E422G	probably benign	Het
Ralyl	A	G	3: 14,143,412	E204G	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rbpms2	TGCCGCCGCC	TGCCGCCGCCGCC	9: 65,651,680		probably benign	Het
Rit1	C	G	3: 88,729,170	T127S	probably damaging	Het
Slc16a7	C	T	10: 125,231,198	V191M	probably damaging	Het
Slc34a2	A	T	5: 53,058,436	H63L	probably benign	Het
Smpd4	G	A	16: 17,642,302		probably null	Het
Sp3	A	G	2: 72,938,176	S748P	possibly damaging	Het
Spata31d1b	G	A	13: 59,715,857	C273Y	probably benign	Het
Spata31d1b	G	A	13: 59,717,465	R809K	probably benign	Het
Tmco5	A	T	2: 116,880,879	E90V	probably damaging	Het
Tnxb	A	T	17: 34,678,910	D844V	probably damaging	Het
Tpi1	T	C	6: 124,814,152	T41A	probably benign	Het
Ttn	T	C	2: 76,727,192	I29853V	probably damaging	Het
Vmn2r26	C	T	6: 124,024,771	T5I	probably benign	Het
Wdr95	A	G	5: 149,599,366	D663G	probably benign	Het
Zbtb39	T	C	10: 127,742,700	F381S	probably damaging	Het
Zfp523	T	A	17: 28,194,993	I34N	probably damaging	Het
Zfp646	T	A	7: 127,879,739	Y363N	probably damaging	Het
Zfp712	A	C	13: 67,042,047	C139G	probably damaging	Het
Zfp958	A	G	8: 4,628,590	H205R	probably damaging	Het
Zfp974	G	A	7: 27,910,356	P648L	possibly damaging	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
R9562:Afg3l2	UTSW	18	67421295	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GCTAAGTACCTCCTTCAGCC -3'
(R):5'- CCCCTAGTCTGATTTTGGGC -3'

Sequencing Primer
(F):5'- GTAGTTTCTGCTACATCCCTCCAAAG -3'
(R):5'- GCAGGAAGTTTAGGCTGCC -3'

Posted On

2014-06-23