Mutagenetix > Incidental Mutation

Incidental Mutation 'R1838:Prune2'

205560

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

MMRRC Submission

039865-MU

Accession Numbers

Genbank: NM_181348

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 17199878 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 212 (W212R)

Ref Sequence

ENSEMBL: ENSMUSP00000153135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689] [ENSMUST00000223920] [ENSMUST00000225351]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087689
AA Change: W2961R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: W2961R

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000223920
AA Change: W212R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224059

Predicted Effect

probably damaging
Transcript: ENSMUST00000225351
AA Change: W212R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000226052
AA Change: W238R

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	T	C	6: 132,626,727	D22G	unknown	Het
Abca4	G	A	3: 122,128,305	R1170K	probably benign	Het
Adam28	T	C	14: 68,639,210	N197S	possibly damaging	Het
Adamtsl3	G	T	7: 82,493,373	R267L	probably damaging	Het
Adgrb2	A	T	4: 130,010,231	T717S	probably benign	Het
Adgrb3	A	G	1: 25,084,270	S1417P	probably damaging	Het
Afg3l2	A	T	18: 67,414,172	V561D	probably damaging	Het
Atp13a2	T	A	4: 140,994,332	Y244*	probably null	Het
BB014433	C	G	8: 15,042,629	V75L	unknown	Het
Btnl6	T	A	17: 34,515,542	D82V	probably damaging	Het
Ccdc178	A	G	18: 22,067,638	Y421H	probably damaging	Het
Cdc123	A	T	2: 5,794,891		probably null	Het
Cdhr5	C	T	7: 141,272,603	V367I	possibly damaging	Het
Celsr3	A	G	9: 108,829,906	H1196R	probably benign	Het
Chd8	T	C	14: 52,204,883	S2077G	probably benign	Het
Col6a5	G	A	9: 105,864,833	H2296Y	probably benign	Het
Ctnna2	T	C	6: 77,845,542	D26G	probably damaging	Het
Ctr9	G	T	7: 111,052,303	R910L	possibly damaging	Het
Cyp2t4	G	T	7: 27,158,416	R455L	possibly damaging	Het
Cyp3a13	A	T	5: 137,911,632		probably null	Het
Dennd3	T	C	15: 73,565,100	S1059P	probably damaging	Het
Dennd4c	A	G	4: 86,825,178	T1135A	probably benign	Het
Dnah7b	T	C	1: 46,116,177	V295A	probably benign	Het
Dnah7b	C	A	1: 46,277,105	T3126K	probably damaging	Het
Ehbp1l1	C	T	19: 5,717,691	E1195K	probably benign	Het
Exoc6b	T	A	6: 84,853,678	I447L	probably benign	Het
Glt1d1	G	A	5: 127,678,129	V202I	probably benign	Het
Grk1	T	C	8: 13,416,155	V533A	possibly damaging	Het
Gsdma3	C	T	11: 98,629,858	A105V	probably benign	Het
Gzma	T	A	13: 113,095,984	I131F	probably damaging	Het
Helq	A	T	5: 100,771,879	L35*	probably null	Het
Hnrnpll	T	C	17: 80,038,623	N403S	probably damaging	Het
Hsf5	A	G	11: 87,636,055	K518E	probably benign	Het
Ighe	T	A	12: 113,271,850	H258L	unknown	Het
Il6ra	T	C	3: 89,890,272	D96G	probably benign	Het
Ints13	C	T	6: 146,566,611	A129T	possibly damaging	Het
Ipo7	T	A	7: 110,042,109	H345Q	probably damaging	Het
Kcna2	A	T	3: 107,104,512	E136D	probably benign	Het
Kif5a	G	A	10: 127,236,815	Q702*	probably null	Het
Klhdc7a	G	T	4: 139,967,070	P189T	probably benign	Het
Krtap4-9	A	G	11: 99,785,396		probably benign	Het
Lamc3	T	C	2: 31,925,582	S1097P	possibly damaging	Het
Ldlrad2	A	T	4: 137,572,170	N114K	probably benign	Het
Lrfn1	A	T	7: 28,459,768	I371L	probably damaging	Het
Lrwd1	A	G	5: 136,132,388	V240A	probably benign	Het
Lypd1	A	T	1: 125,873,371		probably benign	Het
Magi2	A	T	5: 20,465,827	T163S	probably damaging	Het
Man2c1	A	G	9: 57,137,337	N354S	probably benign	Het
Map3k13	T	C	16: 21,914,189	Y514H	possibly damaging	Het
Med15	T	C	16: 17,653,562	D577G	probably benign	Het
Mroh4	A	T	15: 74,616,113	M320K	probably benign	Het
Ms4a10	T	A	19: 10,964,047	D186V	possibly damaging	Het
Myh7	T	C	14: 54,973,180	N1725S	possibly damaging	Het
Myo5c	A	T	9: 75,273,553	R741S	probably damaging	Het
Naip6	T	C	13: 100,316,136	D139G	probably damaging	Het
Nat6	G	A	9: 107,583,017	R37H	possibly damaging	Het
Olfr1252	A	T	2: 89,721,709	M134K	probably damaging	Het
Olfr1370	A	T	13: 21,072,425	L292*	probably null	Het
Olfr229	A	T	9: 39,909,841	I13F	possibly damaging	Het
Olfr982	A	T	9: 40,074,309	M5L	probably benign	Het
Pcdhb3	A	G	18: 37,301,317	D112G	probably benign	Het
Pdpr	C	A	8: 111,134,734	P787T	probably damaging	Het
Pgm3	C	T	9: 86,569,233	V123I	probably benign	Het
Pms1	A	C	1: 53,192,098		probably null	Het
Prl2b1	A	G	13: 27,388,566	S14P	possibly damaging	Het
Rabgef1	A	G	5: 130,213,021	E422G	probably benign	Het
Ralyl	A	G	3: 14,143,412	E204G	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rbpms2	TGCCGCCGCC	TGCCGCCGCCGCC	9: 65,651,680		probably benign	Het
Rit1	C	G	3: 88,729,170	T127S	probably damaging	Het
Slc16a7	C	T	10: 125,231,198	V191M	probably damaging	Het
Slc34a2	A	T	5: 53,058,436	H63L	probably benign	Het
Smpd4	G	A	16: 17,642,302		probably null	Het
Sp3	A	G	2: 72,938,176	S748P	possibly damaging	Het
Spata31d1b	G	A	13: 59,715,857	C273Y	probably benign	Het
Spata31d1b	G	A	13: 59,717,465	R809K	probably benign	Het
Tmco5	A	T	2: 116,880,879	E90V	probably damaging	Het
Tnxb	A	T	17: 34,678,910	D844V	probably damaging	Het
Tpi1	T	C	6: 124,814,152	T41A	probably benign	Het
Ttn	T	C	2: 76,727,192	I29853V	probably damaging	Het
Vmn2r26	C	T	6: 124,024,771	T5I	probably benign	Het
Wdr95	A	G	5: 149,599,366	D663G	probably benign	Het
Zbtb39	T	C	10: 127,742,700	F381S	probably damaging	Het
Zfp523	T	A	17: 28,194,993	I34N	probably damaging	Het
Zfp646	T	A	7: 127,879,739	Y363N	probably damaging	Het
Zfp712	A	C	13: 67,042,047	C139G	probably damaging	Het
Zfp958	A	G	8: 4,628,590	H205R	probably damaging	Het
Zfp974	G	A	7: 27,910,356	P648L	possibly damaging	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0531:Prune2	UTSW	19	17006753	missense	probably damaging	1.00
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0554:Prune2	UTSW	19	17125218	nonsense	probably null
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1851:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1852:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1911:Prune2	UTSW	19	17113674	missense	probably benign	0.02
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2111:Prune2	UTSW	19	17208238	missense	probably damaging	1.00
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4022:Prune2	UTSW	19	17000020	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4922:Prune2	UTSW	19	17122752	missense	probably benign	0.00
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
R7872:Prune2	UTSW	19	17119434	missense	probably benign	0.05
R7881:Prune2	UTSW	19	17123029	missense	possibly damaging	0.50
R7966:Prune2	UTSW	19	17178859	missense	probably damaging	0.99
R7969:Prune2	UTSW	19	17201670	missense	probably damaging	0.98
R8092:Prune2	UTSW	19	17119993	missense	probably damaging	1.00
R8110:Prune2	UTSW	19	17120719	missense	probably benign	0.22
R8115:Prune2	UTSW	19	17123924	missense	probably benign	0.02
R8129:Prune2	UTSW	19	17118836	missense	probably benign	0.01
R8169:Prune2	UTSW	19	17125091	missense	probably benign	0.10
R8171:Prune2	UTSW	19	17120518	missense	probably damaging	1.00
R8176:Prune2	UTSW	19	17118292	missense	probably damaging	1.00
R8200:Prune2	UTSW	19	17124973	missense	probably benign	0.01
R8217:Prune2	UTSW	19	17120116	missense	probably benign	0.01
R8258:Prune2	UTSW	19	17212308	missense	unknown
R8259:Prune2	UTSW	19	17212308	missense	unknown
R8289:Prune2	UTSW	19	17123009	missense	probably benign	0.43
R8329:Prune2	UTSW	19	17121265	missense	probably benign	0.02
R8342:Prune2	UTSW	19	17125663	missense	probably benign	0.01
R8558:Prune2	UTSW	19	17122238	missense	probably damaging	0.98
R8732:Prune2	UTSW	19	17120405	missense	probably damaging	1.00
R8743:Prune2	UTSW	19	17119556	missense	probably benign	0.22
R8769:Prune2	UTSW	19	17123078	missense	probably damaging	0.96
R8862:Prune2	UTSW	19	17120146	missense	probably benign	0.04
R8936:Prune2	UTSW	19	17121835	missense	probably benign	0.24
R9040:Prune2	UTSW	19	17120627	missense	probably damaging	1.00
R9084:Prune2	UTSW	19	17120377	missense	probably damaging	1.00
R9224:Prune2	UTSW	19	17120029	missense	probably damaging	1.00
R9273:Prune2	UTSW	19	17118326	missense	possibly damaging	0.74
R9275:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9278:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9290:Prune2	UTSW	19	17168327	missense	probably benign	0.41
R9305:Prune2	UTSW	19	17120261	missense	probably benign	0.14
R9317:Prune2	UTSW	19	17121670	missense	probably benign	0.00
R9354:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R9373:Prune2	UTSW	19	17122138	missense	probably benign
R9394:Prune2	UTSW	19	17003689	missense	probably damaging	1.00
R9405:Prune2	UTSW	19	17216344	missense	probably damaging	0.99
R9476:Prune2	UTSW	19	17119342	missense	possibly damaging	0.64
R9532:Prune2	UTSW	19	17122430	missense	probably benign	0.00
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGACCACGTACCACTGTTC -3'
(R):5'- TCCAGGAAGGAGCAGCTTTAAG -3'

Sequencing Primer
(F):5'- TCACCCTGTAATTTGAATGTCAC -3'
(R):5'- TGCCTGTACTGTATAGGC -3'

Posted On

2014-06-23