Incidental Mutation 'R1839:Ppp1r12b'
Institutional Source Beutler Lab
Gene Symbol Ppp1r12b
Ensembl Gene ENSMUSG00000073557
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12B
Synonyms9530009M10Rik, 1810037O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R1839 (G1)
Quality Score225
Status Validated
Chromosomal Location134754658-134955942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134837981 bp
Amino Acid Change Arginine to Glycine at position 667 (R667G)
Ref Sequence ENSEMBL: ENSMUSP00000047463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045665] [ENSMUST00000086444] [ENSMUST00000168381]
Predicted Effect probably benign
Transcript: ENSMUST00000045665
AA Change: R667G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047463
Gene: ENSMUSG00000073557
AA Change: R667G

low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 2.45e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 2.45e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086444
AA Change: R667G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083633
Gene: ENSMUSG00000073557
AA Change: R667G

low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
Pfam:PRKG1_interact 875 982 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156348
Predicted Effect probably benign
Transcript: ENSMUST00000168381
AA Change: R667G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131406
Gene: ENSMUSG00000073557
AA Change: R667G

low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 986 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188123
Meta Mutation Damage Score 0.1001 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Ppp1r12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Ppp1r12b APN 1 134892159 missense probably damaging 1.00
IGL01788:Ppp1r12b APN 1 134893507 missense possibly damaging 0.66
IGL01880:Ppp1r12b APN 1 134886421 critical splice donor site probably null
IGL02109:Ppp1r12b APN 1 134872805 critical splice donor site probably null
IGL02247:Ppp1r12b APN 1 134835983 missense probably benign
IGL02336:Ppp1r12b APN 1 134886506 missense probably damaging 1.00
IGL02903:Ppp1r12b APN 1 134955649 missense probably benign
IGL02963:Ppp1r12b APN 1 134886548 missense probably damaging 1.00
IGL03074:Ppp1r12b APN 1 134836020 missense probably benign 0.01
IGL03302:Ppp1r12b APN 1 134838050 splice site probably benign
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0189:Ppp1r12b UTSW 1 134865776 critical splice donor site probably null
R0556:Ppp1r12b UTSW 1 134777322 missense probably damaging 1.00
R0594:Ppp1r12b UTSW 1 134776479 missense probably damaging 1.00
R0690:Ppp1r12b UTSW 1 134876082 missense probably damaging 1.00
R1354:Ppp1r12b UTSW 1 134835983 missense probably benign 0.42
R1676:Ppp1r12b UTSW 1 134777452 missense probably damaging 1.00
R1775:Ppp1r12b UTSW 1 134893348 critical splice donor site probably null
R1946:Ppp1r12b UTSW 1 134892270 missense probably damaging 1.00
R1971:Ppp1r12b UTSW 1 134865913 missense probably benign 0.00
R1997:Ppp1r12b UTSW 1 134846355 intron probably benign
R3110:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3112:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3908:Ppp1r12b UTSW 1 134842732 missense probably damaging 1.00
R3912:Ppp1r12b UTSW 1 134887318 missense probably damaging 1.00
R3977:Ppp1r12b UTSW 1 134765975 missense probably benign 0.00
R4243:Ppp1r12b UTSW 1 134782108 intron probably benign
R4835:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4836:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4843:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4854:Ppp1r12b UTSW 1 134873951 missense probably damaging 1.00
R4870:Ppp1r12b UTSW 1 134949033 missense probably benign 0.00
R4881:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5024:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5054:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5055:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5056:Ppp1r12b UTSW 1 134834392 intron probably benign
R5056:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5158:Ppp1r12b UTSW 1 134886428 missense probably damaging 1.00
R5599:Ppp1r12b UTSW 1 134865907 missense probably benign 0.08
R5771:Ppp1r12b UTSW 1 134773424 critical splice donor site probably null
R5775:Ppp1r12b UTSW 1 134876042 missense probably benign
R5872:Ppp1r12b UTSW 1 134776406 missense probably benign 0.03
R5896:Ppp1r12b UTSW 1 134765981 missense probably damaging 1.00
R6060:Ppp1r12b UTSW 1 134955524 missense possibly damaging 0.82
R6129:Ppp1r12b UTSW 1 134892252 nonsense probably null
R6369:Ppp1r12b UTSW 1 134886542 missense possibly damaging 0.93
R6868:Ppp1r12b UTSW 1 134886438 missense probably benign 0.00
R7681:Ppp1r12b UTSW 1 134865935 missense probably benign 0.02
R7940:Ppp1r12b UTSW 1 134876055 missense probably benign 0.00
R8057:Ppp1r12b UTSW 1 134955616 missense probably damaging 1.00
R8070:Ppp1r12b UTSW 1 134876069 missense probably benign 0.06
R8134:Ppp1r12b UTSW 1 134886542 missense possibly damaging 0.93
R8147:Ppp1r12b UTSW 1 134873942 missense possibly damaging 0.78
R8224:Ppp1r12b UTSW 1 134902462 missense probably benign 0.19
R8270:Ppp1r12b UTSW 1 134876148 missense probably benign 0.37
R8304:Ppp1r12b UTSW 1 134896363 missense possibly damaging 0.65
X0022:Ppp1r12b UTSW 1 134835873 missense probably benign 0.00
X0027:Ppp1r12b UTSW 1 134896354 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-06-23