Incidental Mutation 'R1839:Sstr4'
ID 205571
Institutional Source Beutler Lab
Gene Symbol Sstr4
Ensembl Gene ENSMUSG00000037014
Gene Name somatostatin receptor 4
Synonyms Smstr4, sst4
MMRRC Submission 045015-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.259) question?
Stock # R1839 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 148395344-148396767 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 148395533 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 21 (N21K)
Ref Sequence ENSEMBL: ENSMUSP00000105588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109962]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109962
AA Change: N21K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105588
Gene: ENSMUSG00000037014
AA Change: N21K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 55 323 4.7e-16 PFAM
Pfam:7tm_1 61 308 2.2e-61 PFAM
Pfam:7TM_GPCR_Srv 117 325 1.8e-10 PFAM
Pfam:7TM_GPCR_Srw 203 326 8.1e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have increased susceptibility to inflammation, delayed type hypersensitivity, hyperalgesia and airway hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 (GRCm38) T403A probably damaging Het
Acat3 T A 17: 12,928,606 (GRCm38) R175* probably null Het
Adam1b C A 5: 121,501,041 (GRCm38) C647F probably damaging Het
Adam28 T C 14: 68,639,210 (GRCm38) N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 (GRCm38) probably null Het
Adcy5 A T 16: 35,248,940 (GRCm38) N426I probably damaging Het
Adgre1 T C 17: 57,441,299 (GRCm38) S500P probably benign Het
Aloxe3 A G 11: 69,130,085 (GRCm38) Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 (GRCm38) S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 (GRCm38) R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 (GRCm38) A757S possibly damaging Het
Begain G A 12: 109,035,323 (GRCm38) probably benign Het
Ccdc141 T C 2: 77,011,665 (GRCm38) E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 (GRCm38) probably benign Het
Ccnk A G 12: 108,195,074 (GRCm38) T195A probably damaging Het
Cd55b C A 1: 130,414,105 (GRCm38) C265F probably damaging Het
Celsr3 A G 9: 108,829,906 (GRCm38) H1196R probably benign Het
Cenpt T C 8: 105,849,014 (GRCm38) S190G possibly damaging Het
Chd8 T C 14: 52,204,883 (GRCm38) S2077G probably benign Het
Col6a5 G A 9: 105,864,833 (GRCm38) H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 (GRCm38) H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 (GRCm38) I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 (GRCm38) L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 (GRCm38) I47V probably benign Het
Ddx5 A T 11: 106,784,897 (GRCm38) D322E probably benign Het
Dhx40 A G 11: 86,789,297 (GRCm38) C405R possibly damaging Het
Emc1 T C 4: 139,360,485 (GRCm38) F100S probably damaging Het
Exoc2 T C 13: 30,906,497 (GRCm38) probably benign Het
Gm10110 A T 14: 89,897,836 (GRCm38) noncoding transcript Het
Gm17332 T C 11: 31,182,386 (GRCm38) H26R possibly damaging Het
Gna12 T C 5: 140,762,612 (GRCm38) N183S probably benign Het
Gpx6 A G 13: 21,312,327 (GRCm38) N24D probably benign Het
Gsdma3 C T 11: 98,629,858 (GRCm38) A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 (GRCm38) Y134C probably benign Het
Ifi213 T C 1: 173,589,600 (GRCm38) I415M probably damaging Het
Ints9 C A 14: 65,016,530 (GRCm38) P278T probably damaging Het
Krt79 C T 15: 101,937,938 (GRCm38) E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 (GRCm38) N132S probably benign Het
Ltn1 T A 16: 87,416,264 (GRCm38) K470* probably null Het
Magi2 A T 5: 20,465,827 (GRCm38) T163S probably damaging Het
Mcm9 A G 10: 53,541,553 (GRCm38) M18T probably damaging Het
Med12l A G 3: 59,068,319 (GRCm38) T212A probably benign Het
Mfhas1 T C 8: 35,590,858 (GRCm38) L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 (GRCm38) C288S probably benign Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myh7 T C 14: 54,973,180 (GRCm38) N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 (GRCm38) R37H possibly damaging Het
Nme4 A T 17: 26,092,097 (GRCm38) W165R probably damaging Het
Nup205 T A 6: 35,219,714 (GRCm38) D1128E probably benign Het
Olfr291 T C 7: 84,856,548 (GRCm38) Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 (GRCm38) Y204* probably null Het
Pcdh1 T C 18: 38,199,485 (GRCm38) D155G possibly damaging Het
Pex12 A T 11: 83,297,822 (GRCm38) S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 (GRCm38) probably benign Het
Plekhh3 A G 11: 101,163,600 (GRCm38) probably benign Het
Pnpt1 T C 11: 29,154,342 (GRCm38) M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 (GRCm38) R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 (GRCm38) probably benign Het
Rgs14 T C 13: 55,382,838 (GRCm38) probably benign Het
Rhbdf2 A T 11: 116,600,191 (GRCm38) V645E possibly damaging Het
Robo3 A G 9: 37,422,327 (GRCm38) V696A probably benign Het
Sall1 A G 8: 89,028,716 (GRCm38) F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 (GRCm38) E109G probably benign Het
Serpind1 G T 16: 17,342,992 (GRCm38) R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 (GRCm38) probably benign Het
Tap1 C T 17: 34,188,109 (GRCm38) A77V possibly damaging Het
Thap4 T C 1: 93,750,287 (GRCm38) E259G probably benign Het
Thra A G 11: 98,756,143 (GRCm38) N30S probably benign Het
Tmem207 A T 16: 26,524,821 (GRCm38) V27E possibly damaging Het
Top3a A G 11: 60,753,888 (GRCm38) V305A probably damaging Het
Trim59 A T 3: 69,037,638 (GRCm38) I123K probably damaging Het
Ttn T C 2: 76,861,495 (GRCm38) probably benign Het
Ubac1 T A 2: 26,007,738 (GRCm38) E290V possibly damaging Het
Unc13b T C 4: 43,258,308 (GRCm38) probably benign Het
Uri1 A T 7: 37,967,389 (GRCm38) D206E probably benign Het
Utp4 A G 8: 106,913,454 (GRCm38) H465R probably benign Het
Uvssa T C 5: 33,389,752 (GRCm38) S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 (GRCm38) probably null Het
Vps39 A T 2: 120,325,397 (GRCm38) L514H probably damaging Het
Vps72 G A 3: 95,119,218 (GRCm38) R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 (GRCm38) D366G probably benign Het
Zfp366 C A 13: 99,228,492 (GRCm38) Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 (GRCm38) I34N probably damaging Het
Zfp974 G A 7: 27,910,356 (GRCm38) P648L possibly damaging Het
Other mutations in Sstr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Sstr4 APN 2 148,395,552 (GRCm38) missense probably benign 0.00
IGL01536:Sstr4 APN 2 148,395,880 (GRCm38) missense probably damaging 1.00
IGL02210:Sstr4 APN 2 148,396,309 (GRCm38) missense probably damaging 1.00
IGL02670:Sstr4 APN 2 148,396,533 (GRCm38) nonsense probably null
R0396:Sstr4 UTSW 2 148,396,261 (GRCm38) missense probably damaging 1.00
R1428:Sstr4 UTSW 2 148,396,359 (GRCm38) missense probably benign 0.01
R2332:Sstr4 UTSW 2 148,396,410 (GRCm38) missense probably damaging 1.00
R2943:Sstr4 UTSW 2 148,396,165 (GRCm38) missense probably damaging 0.96
R3700:Sstr4 UTSW 2 148,396,353 (GRCm38) missense possibly damaging 0.57
R5502:Sstr4 UTSW 2 148,395,551 (GRCm38) small insertion probably benign
R5503:Sstr4 UTSW 2 148,395,551 (GRCm38) small insertion probably benign
R5596:Sstr4 UTSW 2 148,395,732 (GRCm38) missense possibly damaging 0.65
R5726:Sstr4 UTSW 2 148,396,083 (GRCm38) missense probably damaging 1.00
R6985:Sstr4 UTSW 2 148,396,249 (GRCm38) missense probably damaging 0.97
R8939:Sstr4 UTSW 2 148,396,308 (GRCm38) missense probably damaging 1.00
R8943:Sstr4 UTSW 2 148,395,862 (GRCm38) missense possibly damaging 0.94
X0022:Sstr4 UTSW 2 148,395,532 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAGCTCTTCGGGCAAAGG -3'
(R):5'- GCTGTCTTCATCTTGGCATAGC -3'

Sequencing Primer
(F):5'- TTCGGGCAAAGGCACCTG -3'
(R):5'- CATCTTGGCATAGCGTAGGATCAC -3'
Posted On 2014-06-23