Incidental Mutation 'R1839:Med12l'
ID 205577
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Name mediator complex subunit 12-like
Synonyms
MMRRC Submission 045015-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.257) question?
Stock # R1839 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 58913246-59226103 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58975740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 212 (T212A)
Ref Sequence ENSEMBL: ENSMUSP00000142903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029393] [ENSMUST00000040325] [ENSMUST00000040846] [ENSMUST00000164225] [ENSMUST00000199659]
AlphaFold Q8BQM9
Predicted Effect probably benign
Transcript: ENSMUST00000029393
AA Change: T223A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029393
Gene: ENSMUSG00000056476
AA Change: T223A

DomainStartEndE-ValueType
Med12 101 172 1.54e-17 SMART
low complexity region 227 235 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Pfam:Med12-LCEWAV 293 737 1.6e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040325
AA Change: T212A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: T212A

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040846
AA Change: T223A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041859
Gene: ENSMUSG00000056476
AA Change: T223A

DomainStartEndE-ValueType
Med12 101 172 1.54e-17 SMART
low complexity region 227 235 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Pfam:Med12-LCEWAV 293 728 9e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
AA Change: T212A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: T212A

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
AA Change: T212A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: T212A

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,369 (GRCm39) T403A probably damaging Het
Acat3 T A 17: 13,147,493 (GRCm39) R175* probably null Het
Adam1b C A 5: 121,639,104 (GRCm39) C647F probably damaging Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adcy2 C T 13: 68,837,380 (GRCm39) probably null Het
Adcy5 A T 16: 35,069,310 (GRCm39) N426I probably damaging Het
Adgre1 T C 17: 57,748,299 (GRCm39) S500P probably benign Het
Aloxe3 A G 11: 69,020,911 (GRCm39) Y212C probably damaging Het
Ap3d1 A G 10: 80,562,942 (GRCm39) S180P probably damaging Het
Arhgap20 C T 9: 51,760,626 (GRCm39) R790W probably damaging Het
Atp8b4 C A 2: 126,203,702 (GRCm39) A757S possibly damaging Het
Begain G A 12: 109,001,249 (GRCm39) probably benign Het
Ccdc141 T C 2: 76,842,009 (GRCm39) E1474G probably benign Het
Ccdc88b A G 19: 6,831,477 (GRCm39) probably benign Het
Ccnk A G 12: 108,161,333 (GRCm39) T195A probably damaging Het
Cd55b C A 1: 130,341,842 (GRCm39) C265F probably damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Cenpt T C 8: 106,575,646 (GRCm39) S190G possibly damaging Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Cxxc4 C A 3: 133,946,414 (GRCm39) H332N probably damaging Het
Cyp24a1 T C 2: 170,338,661 (GRCm39) I12V probably benign Het
Cyp3a57 T A 5: 145,318,111 (GRCm39) L364Q probably damaging Het
Ddi2 T C 4: 141,440,837 (GRCm39) I47V probably benign Het
Ddx5 A T 11: 106,675,723 (GRCm39) D322E probably benign Het
Dhx40 A G 11: 86,680,123 (GRCm39) C405R possibly damaging Het
Emc1 T C 4: 139,087,796 (GRCm39) F100S probably damaging Het
Exoc2 T C 13: 31,090,480 (GRCm39) probably benign Het
Gm10110 A T 14: 90,135,272 (GRCm39) noncoding transcript Het
Gm17332 T C 11: 31,132,386 (GRCm39) H26R possibly damaging Het
Gna12 T C 5: 140,748,367 (GRCm39) N183S probably benign Het
Gpx6 A G 13: 21,496,497 (GRCm39) N24D probably benign Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Hsd3b5 T C 3: 98,527,044 (GRCm39) Y134C probably benign Het
Ifi213 T C 1: 173,417,166 (GRCm39) I415M probably damaging Het
Ints9 C A 14: 65,253,979 (GRCm39) P278T probably damaging Het
Krt79 C T 15: 101,846,373 (GRCm39) E192K possibly damaging Het
Lrrk2 A G 15: 91,567,337 (GRCm39) N132S probably benign Het
Ltn1 T A 16: 87,213,152 (GRCm39) K470* probably null Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Mcm9 A G 10: 53,417,649 (GRCm39) M18T probably damaging Het
Mfhas1 T C 8: 36,058,012 (GRCm39) L829P possibly damaging Het
Mgme1 T A 2: 144,121,407 (GRCm39) C288S probably benign Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Nme4 A T 17: 26,311,071 (GRCm39) W165R probably damaging Het
Nup205 T A 6: 35,196,649 (GRCm39) D1128E probably benign Het
Or2t48 A T 11: 58,420,199 (GRCm39) Y204* probably null Het
Or5ae2 T C 7: 84,505,756 (GRCm39) Y60H probably damaging Het
Pcdh1 T C 18: 38,332,538 (GRCm39) D155G possibly damaging Het
Pex12 A T 11: 83,188,648 (GRCm39) S116T probably damaging Het
Plekhh1 C T 12: 79,125,731 (GRCm39) probably benign Het
Plekhh3 A G 11: 101,054,426 (GRCm39) probably benign Het
Pnpt1 T C 11: 29,104,342 (GRCm39) M572T possibly damaging Het
Ppp1r12b T C 1: 134,765,719 (GRCm39) R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rgs14 T C 13: 55,530,651 (GRCm39) probably benign Het
Rhbdf2 A T 11: 116,491,017 (GRCm39) V645E possibly damaging Het
Robo3 A G 9: 37,333,623 (GRCm39) V696A probably benign Het
Sall1 A G 8: 89,755,344 (GRCm39) F1212L possibly damaging Het
Sdc4 T C 2: 164,270,932 (GRCm39) E109G probably benign Het
Serpind1 G T 16: 17,160,856 (GRCm39) R462L probably damaging Het
Smad9 CTTT CTT 3: 54,696,600 (GRCm39) probably benign Het
Sstr4 C A 2: 148,237,453 (GRCm39) N21K probably benign Het
Tap1 C T 17: 34,407,083 (GRCm39) A77V possibly damaging Het
Thap4 T C 1: 93,678,009 (GRCm39) E259G probably benign Het
Thra A G 11: 98,646,969 (GRCm39) N30S probably benign Het
Tmem207 A T 16: 26,343,571 (GRCm39) V27E possibly damaging Het
Top3a A G 11: 60,644,714 (GRCm39) V305A probably damaging Het
Trim59 A T 3: 68,944,971 (GRCm39) I123K probably damaging Het
Ttn T C 2: 76,691,839 (GRCm39) probably benign Het
Ubac1 T A 2: 25,897,750 (GRCm39) E290V possibly damaging Het
Unc13b T C 4: 43,258,308 (GRCm39) probably benign Het
Uri1 A T 7: 37,666,814 (GRCm39) D206E probably benign Het
Utp4 A G 8: 107,640,086 (GRCm39) H465R probably benign Het
Uvssa T C 5: 33,547,096 (GRCm39) S221P probably benign Het
Vmn1r39 T C 6: 66,782,217 (GRCm39) probably null Het
Vps39 A T 2: 120,155,878 (GRCm39) L514H probably damaging Het
Vps72 G A 3: 95,026,529 (GRCm39) R158Q possibly damaging Het
Wdr59 T C 8: 112,211,972 (GRCm39) D366G probably benign Het
Zfp366 C A 13: 99,365,000 (GRCm39) Q54K probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 58,949,757 (GRCm39) missense probably damaging 0.98
IGL00561:Med12l APN 3 59,135,245 (GRCm39) missense probably benign
IGL00974:Med12l APN 3 58,990,435 (GRCm39) missense probably damaging 1.00
IGL01024:Med12l APN 3 58,980,762 (GRCm39) missense probably damaging 1.00
IGL01094:Med12l APN 3 59,001,076 (GRCm39) missense probably damaging 0.99
IGL01134:Med12l APN 3 58,949,696 (GRCm39) missense possibly damaging 0.91
IGL01535:Med12l APN 3 59,169,680 (GRCm39) missense probably damaging 1.00
IGL01653:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL01735:Med12l APN 3 59,170,675 (GRCm39) missense probably damaging 1.00
IGL01972:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL02005:Med12l APN 3 59,152,368 (GRCm39) missense probably damaging 1.00
IGL02098:Med12l APN 3 59,183,276 (GRCm39) missense possibly damaging 0.92
IGL02115:Med12l APN 3 58,975,740 (GRCm39) missense probably benign 0.00
IGL02231:Med12l APN 3 59,153,303 (GRCm39) missense probably damaging 1.00
IGL02259:Med12l APN 3 59,153,264 (GRCm39) missense probably damaging 1.00
IGL02369:Med12l APN 3 59,164,794 (GRCm39) missense probably benign 0.00
IGL02424:Med12l APN 3 59,000,143 (GRCm39) missense probably benign 0.21
IGL02501:Med12l APN 3 59,169,397 (GRCm39) missense possibly damaging 0.71
IGL02525:Med12l APN 3 58,975,789 (GRCm39) missense probably benign 0.01
IGL02530:Med12l APN 3 58,984,510 (GRCm39) missense probably damaging 1.00
IGL02735:Med12l APN 3 59,001,067 (GRCm39) missense probably damaging 1.00
IGL02865:Med12l APN 3 59,201,713 (GRCm39) missense probably damaging 1.00
IGL03183:Med12l APN 3 58,944,976 (GRCm39) splice site probably null
IGL03264:Med12l APN 3 59,208,788 (GRCm39) nonsense probably null
FR4304:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4340:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,415 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,409 (GRCm39) small insertion probably benign
FR4449:Med12l UTSW 3 59,183,384 (GRCm39) nonsense probably null
FR4548:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4589:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
FR4976:Med12l UTSW 3 59,183,398 (GRCm39) small insertion probably benign
P0007:Med12l UTSW 3 58,998,816 (GRCm39) splice site probably benign
P0045:Med12l UTSW 3 58,998,956 (GRCm39) missense probably damaging 0.99
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0148:Med12l UTSW 3 58,945,075 (GRCm39) missense probably damaging 1.00
R0325:Med12l UTSW 3 58,984,480 (GRCm39) missense possibly damaging 0.88
R0330:Med12l UTSW 3 59,135,123 (GRCm39) missense probably damaging 1.00
R0388:Med12l UTSW 3 59,000,925 (GRCm39) splice site probably benign
R0542:Med12l UTSW 3 58,949,822 (GRCm39) missense probably damaging 1.00
R0624:Med12l UTSW 3 58,945,123 (GRCm39) nonsense probably null
R0625:Med12l UTSW 3 59,154,858 (GRCm39) missense probably damaging 1.00
R0671:Med12l UTSW 3 59,172,350 (GRCm39) missense probably damaging 1.00
R0706:Med12l UTSW 3 59,169,401 (GRCm39) missense probably damaging 1.00
R0785:Med12l UTSW 3 59,168,253 (GRCm39) missense probably damaging 1.00
R1054:Med12l UTSW 3 59,156,072 (GRCm39) missense probably damaging 0.99
R1102:Med12l UTSW 3 59,152,257 (GRCm39) missense probably damaging 0.99
R1391:Med12l UTSW 3 58,945,159 (GRCm39) missense probably benign 0.00
R1501:Med12l UTSW 3 59,168,256 (GRCm39) critical splice donor site probably null
R1544:Med12l UTSW 3 59,172,661 (GRCm39) missense possibly damaging 0.71
R1662:Med12l UTSW 3 59,001,038 (GRCm39) missense probably damaging 1.00
R1670:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
R1854:Med12l UTSW 3 59,168,193 (GRCm39) missense probably damaging 1.00
R2045:Med12l UTSW 3 59,169,731 (GRCm39) nonsense probably null
R2070:Med12l UTSW 3 59,152,326 (GRCm39) missense probably damaging 1.00
R2132:Med12l UTSW 3 59,172,703 (GRCm39) splice site probably null
R2290:Med12l UTSW 3 59,152,359 (GRCm39) missense probably damaging 1.00
R2325:Med12l UTSW 3 59,139,875 (GRCm39) missense probably damaging 0.99
R2352:Med12l UTSW 3 59,148,113 (GRCm39) missense probably damaging 1.00
R2484:Med12l UTSW 3 59,205,259 (GRCm39) missense probably benign 0.18
R2906:Med12l UTSW 3 59,164,503 (GRCm39) missense probably damaging 1.00
R3735:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3736:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3774:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R3957:Med12l UTSW 3 58,980,589 (GRCm39) missense probably damaging 0.99
R4020:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R4087:Med12l UTSW 3 59,205,342 (GRCm39) missense probably benign 0.00
R4231:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4233:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4235:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4236:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4327:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4328:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4346:Med12l UTSW 3 58,938,976 (GRCm39) missense probably damaging 1.00
R4543:Med12l UTSW 3 58,998,929 (GRCm39) missense probably damaging 1.00
R4559:Med12l UTSW 3 58,914,523 (GRCm39) critical splice donor site probably null
R4776:Med12l UTSW 3 59,140,633 (GRCm39) missense probably damaging 1.00
R4877:Med12l UTSW 3 59,152,214 (GRCm39) missense probably damaging 1.00
R4983:Med12l UTSW 3 59,169,350 (GRCm39) missense probably damaging 1.00
R5114:Med12l UTSW 3 59,167,109 (GRCm39) missense possibly damaging 0.85
R5125:Med12l UTSW 3 59,174,635 (GRCm39) missense possibly damaging 0.83
R5230:Med12l UTSW 3 59,153,209 (GRCm39) missense probably damaging 1.00
R5407:Med12l UTSW 3 59,165,622 (GRCm39) missense probably damaging 1.00
R5426:Med12l UTSW 3 59,156,143 (GRCm39) missense probably damaging 0.98
R5439:Med12l UTSW 3 59,170,634 (GRCm39) missense probably null 1.00
R5449:Med12l UTSW 3 59,167,127 (GRCm39) missense probably damaging 1.00
R5596:Med12l UTSW 3 59,159,771 (GRCm39) missense probably benign 0.45
R5716:Med12l UTSW 3 59,208,798 (GRCm39) critical splice donor site probably null
R5833:Med12l UTSW 3 59,172,647 (GRCm39) missense possibly damaging 0.95
R5883:Med12l UTSW 3 58,998,889 (GRCm39) missense probably damaging 1.00
R6264:Med12l UTSW 3 59,163,423 (GRCm39) missense probably damaging 1.00
R6269:Med12l UTSW 3 59,135,243 (GRCm39) missense probably damaging 1.00
R6394:Med12l UTSW 3 59,142,508 (GRCm39) missense probably damaging 1.00
R6400:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R6475:Med12l UTSW 3 59,164,500 (GRCm39) missense probably damaging 1.00
R6489:Med12l UTSW 3 59,164,828 (GRCm39) missense probably damaging 0.99
R6654:Med12l UTSW 3 59,169,713 (GRCm39) missense probably damaging 1.00
R6881:Med12l UTSW 3 59,174,586 (GRCm39) missense probably benign 0.00
R7110:Med12l UTSW 3 59,169,645 (GRCm39) missense possibly damaging 0.92
R7134:Med12l UTSW 3 59,001,180 (GRCm39) nonsense probably null
R7137:Med12l UTSW 3 59,165,675 (GRCm39) missense probably damaging 1.00
R7159:Med12l UTSW 3 59,183,438 (GRCm39) missense probably benign
R7341:Med12l UTSW 3 58,949,824 (GRCm39) missense possibly damaging 0.53
R7349:Med12l UTSW 3 59,165,746 (GRCm39) missense probably damaging 1.00
R7413:Med12l UTSW 3 58,998,971 (GRCm39) missense probably benign 0.00
R7495:Med12l UTSW 3 59,152,194 (GRCm39) missense probably damaging 1.00
R7678:Med12l UTSW 3 58,984,141 (GRCm39) missense probably damaging 1.00
R7697:Med12l UTSW 3 59,148,078 (GRCm39) missense probably damaging 1.00
R7714:Med12l UTSW 3 59,001,007 (GRCm39) missense probably benign 0.17
R7725:Med12l UTSW 3 59,163,413 (GRCm39) missense probably damaging 1.00
R7846:Med12l UTSW 3 59,172,355 (GRCm39) missense probably damaging 1.00
R7852:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R8080:Med12l UTSW 3 59,172,607 (GRCm39) missense probably damaging 1.00
R8181:Med12l UTSW 3 59,169,389 (GRCm39) missense probably damaging 1.00
R8223:Med12l UTSW 3 58,993,784 (GRCm39) missense possibly damaging 0.79
R8560:Med12l UTSW 3 58,945,026 (GRCm39) missense probably damaging 1.00
R8708:Med12l UTSW 3 59,159,751 (GRCm39) missense probably benign 0.00
R8865:Med12l UTSW 3 58,979,303 (GRCm39) missense probably benign
R8947:Med12l UTSW 3 58,984,443 (GRCm39) splice site probably benign
R8976:Med12l UTSW 3 59,183,329 (GRCm39) missense probably damaging 0.99
R9016:Med12l UTSW 3 59,163,294 (GRCm39) missense probably damaging 0.96
R9183:Med12l UTSW 3 58,984,498 (GRCm39) missense probably damaging 1.00
R9487:Med12l UTSW 3 59,155,353 (GRCm39) missense probably benign
R9526:Med12l UTSW 3 58,984,207 (GRCm39) missense probably damaging 0.96
R9802:Med12l UTSW 3 59,169,346 (GRCm39) missense probably damaging 1.00
RF004:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF011:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF013:Med12l UTSW 3 59,183,387 (GRCm39) small insertion probably benign
RF020:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
RF021:Med12l UTSW 3 58,980,711 (GRCm39) missense probably benign 0.19
RF027:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF027:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF030:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,408 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF037:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF049:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF050:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF053:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF055:Med12l UTSW 3 59,183,404 (GRCm39) small insertion probably benign
RF056:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF057:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
X0062:Med12l UTSW 3 59,140,600 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 59,203,538 (GRCm39) missense probably benign 0.00
Z1176:Med12l UTSW 3 59,152,364 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 58,998,838 (GRCm39) missense probably damaging 0.98
Z1177:Med12l UTSW 3 59,155,296 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGAAATGCCTGCACATGC -3'
(R):5'- AGCATGCATCCCTGTTGTTCAC -3'

Sequencing Primer
(F):5'- ATATGGTGGTTCACAGCCATC -3'
(R):5'- CCATCACATGACTCCTACATGGG -3'
Posted On 2014-06-23