Incidental Mutation 'R1839:Unc13b'
ID 205583
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Name unc-13 homolog B (C. elegans)
Synonyms Unc13h2, Munc13-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock # R1839 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 43058953-43264871 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 43258308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000145899] [ENSMUST00000163653] [ENSMUST00000207569] [ENSMUST00000207708]
AlphaFold Q9Z1N9
Predicted Effect probably benign
Transcript: ENSMUST00000079978
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456

C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456

C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456

C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143653
Predicted Effect probably benign
Transcript: ENSMUST00000145899
SMART Domains Protein: ENSMUSP00000128638
Gene: ENSMUSG00000028456

PDB:3SWH|B 16 190 1e-84 PDB
Blast:DUF1041 55 129 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153168
Predicted Effect probably benign
Transcript: ENSMUST00000163653
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456

C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207569
Predicted Effect probably benign
Transcript: ENSMUST00000207708
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
BB006:Unc13b UTSW 4 43174399 missense unknown
BB016:Unc13b UTSW 4 43174399 missense unknown
G1Funyon:Unc13b UTSW 4 43263568 missense probably benign
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
R7598:Unc13b UTSW 4 43263569 missense probably benign 0.20
R7604:Unc13b UTSW 4 43170102 missense unknown
R7604:Unc13b UTSW 4 43256776 missense possibly damaging 0.95
R7643:Unc13b UTSW 4 43216333 missense probably benign
R7718:Unc13b UTSW 4 43173854 missense unknown
R7735:Unc13b UTSW 4 43165791 missense probably damaging 1.00
R7756:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177330 small insertion probably benign
R7757:Unc13b UTSW 4 43177341 small insertion probably benign
R7758:Unc13b UTSW 4 43177312 small insertion probably benign
R7758:Unc13b UTSW 4 43177344 small insertion probably benign
R7781:Unc13b UTSW 4 43259546 missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43172737 missense unknown
R7858:Unc13b UTSW 4 43176285 missense unknown
R7867:Unc13b UTSW 4 43232573 nonsense probably null
R7897:Unc13b UTSW 4 43171860 missense unknown
R7904:Unc13b UTSW 4 43217075 missense probably benign
R7929:Unc13b UTSW 4 43174399 missense unknown
R7984:Unc13b UTSW 4 43173973 missense unknown
R8069:Unc13b UTSW 4 43177597 missense unknown
R8101:Unc13b UTSW 4 43239918 missense probably benign 0.08
R8246:Unc13b UTSW 4 43175954 missense unknown
R8289:Unc13b UTSW 4 43172524 nonsense probably null
R8301:Unc13b UTSW 4 43263568 missense probably benign
R8397:Unc13b UTSW 4 43217290 missense probably benign 0.12
R8421:Unc13b UTSW 4 43178304 missense unknown
R8738:Unc13b UTSW 4 43177564 missense unknown
R8746:Unc13b UTSW 4 43176120 missense unknown
R8766:Unc13b UTSW 4 43174722 missense unknown
R8825:Unc13b UTSW 4 43237683 splice site probably benign
R8834:Unc13b UTSW 4 43175954 missense unknown
R8862:Unc13b UTSW 4 43235207 missense probably damaging 1.00
R8864:Unc13b UTSW 4 43174724 missense unknown
R8889:Unc13b UTSW 4 43176484 missense unknown
R8892:Unc13b UTSW 4 43176484 missense unknown
R8904:Unc13b UTSW 4 43178531 intron probably benign
R9089:Unc13b UTSW 4 43095847 missense probably damaging 1.00
R9144:Unc13b UTSW 4 43173649 missense unknown
R9149:Unc13b UTSW 4 43176186 missense unknown
R9173:Unc13b UTSW 4 43177421 missense unknown
R9200:Unc13b UTSW 4 43257352 missense possibly damaging 0.50
R9232:Unc13b UTSW 4 43240321 missense probably benign 0.03
R9269:Unc13b UTSW 4 43171955 missense unknown
R9320:Unc13b UTSW 4 43171044 missense unknown
R9335:Unc13b UTSW 4 43216123 missense possibly damaging 0.86
R9335:Unc13b UTSW 4 43255551 missense probably damaging 0.99
R9352:Unc13b UTSW 4 43177312 small insertion probably benign
R9352:Unc13b UTSW 4 43177313 nonsense probably null
R9378:Unc13b UTSW 4 43173282 missense unknown
R9382:Unc13b UTSW 4 43172512 missense unknown
R9569:Unc13b UTSW 4 43177312 small deletion probably benign
R9622:Unc13b UTSW 4 43172513 missense
R9687:Unc13b UTSW 4 43174920 missense unknown
R9704:Unc13b UTSW 4 43237102 missense probably benign 0.31
R9721:Unc13b UTSW 4 43101869 missense probably benign
R9753:Unc13b UTSW 4 43182842 nonsense probably null
RF016:Unc13b UTSW 4 43177347 small insertion probably benign
RF016:Unc13b UTSW 4 43177350 small insertion probably benign
RF041:Unc13b UTSW 4 43177338 small insertion probably benign
RF056:Unc13b UTSW 4 43177359 small insertion probably benign
Z1176:Unc13b UTSW 4 43171419 missense unknown
Z1176:Unc13b UTSW 4 43177191 missense unknown
Z1176:Unc13b UTSW 4 43177764 missense unknown
Z1176:Unc13b UTSW 4 43261043 missense probably benign 0.11
Z1177:Unc13b UTSW 4 43173669 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-06-23