Incidental Mutation 'R1839:Uvssa'
ID205588
Institutional Source Beutler Lab
Gene Symbol Uvssa
Ensembl Gene ENSMUSG00000037355
Gene NameUV stimulated scaffold protein A
SynonymsD330017J19Rik, 4933407H18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1839 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33378549-33419754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33389752 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 221 (S221P)
Ref Sequence ENSEMBL: ENSMUSP00000144400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087864] [ENSMUST00000202046] [ENSMUST00000202816]
Predicted Effect probably benign
Transcript: ENSMUST00000087864
AA Change: S221P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000085170
Gene: ENSMUSG00000037355
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200682
Predicted Effect probably benign
Transcript: ENSMUST00000202046
AA Change: S221P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144025
Gene: ENSMUSG00000037355
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202816
AA Change: S221P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144400
Gene: ENSMUSG00000037355
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in ubiquitination and dephosphorylation of RNA polymerase II subunits that stall after UV irradiation. The encoded protein interacts with several members of the nucleotide excision repair complex, and is thought to be involved in the transcription-coupled nucleotide excision repair (TC-NER) pathway to help remove lesions in the DNA that block transcription. Defects in this gene can cause UV-sensitive syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Uvssa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Uvssa APN 5 33408848 missense probably benign 0.00
IGL02136:Uvssa APN 5 33391848 missense probably damaging 1.00
IGL02339:Uvssa APN 5 33414849 missense probably damaging 1.00
IGL03096:Uvssa APN 5 33410924 missense probably benign 0.29
IGL03130:Uvssa APN 5 33391845 missense possibly damaging 0.57
IGL03248:Uvssa APN 5 33391816 missense probably damaging 1.00
PIT1430001:Uvssa UTSW 5 33402570 missense possibly damaging 0.50
PIT4142001:Uvssa UTSW 5 33392084 missense probably benign 0.05
R0326:Uvssa UTSW 5 33408847 missense probably benign 0.01
R0443:Uvssa UTSW 5 33388824 missense possibly damaging 0.68
R1438:Uvssa UTSW 5 33413884 splice site probably benign
R1474:Uvssa UTSW 5 33388821 missense probably benign 0.00
R1521:Uvssa UTSW 5 33413934 missense probably damaging 0.99
R1522:Uvssa UTSW 5 33387808 missense probably damaging 1.00
R2223:Uvssa UTSW 5 33392063 missense probably damaging 1.00
R3404:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3405:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3406:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3892:Uvssa UTSW 5 33389752 missense probably benign 0.04
R4624:Uvssa UTSW 5 33389956 missense possibly damaging 0.87
R4898:Uvssa UTSW 5 33413913 nonsense probably null
R5413:Uvssa UTSW 5 33410908 missense probably damaging 1.00
R5921:Uvssa UTSW 5 33389752 missense probably benign 0.00
R5977:Uvssa UTSW 5 33389860 missense probably damaging 1.00
R6198:Uvssa UTSW 5 33409510 missense probably damaging 1.00
R6566:Uvssa UTSW 5 33392176 missense possibly damaging 0.66
R6884:Uvssa UTSW 5 33409117 intron probably null
R8022:Uvssa UTSW 5 33409504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTTATATGCCAGTCCACTTG -3'
(R):5'- TTGGGGTAGTGCCTTCAGAC -3'

Sequencing Primer
(F):5'- GAAGCAGTCTTGGCCATCTG -3'
(R):5'- GGTAGTGCCTTCAGACCAACAAC -3'
Posted On2014-06-23