Incidental Mutation 'R1839:Nup205'
ID205592
Institutional Source Beutler Lab
Gene Symbol Nup205
Ensembl Gene ENSMUSG00000038759
Gene Namenucleoporin 205
Synonyms3830404O05Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R1839 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location35177421-35247596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35219714 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1128 (D1128E)
Ref Sequence ENSEMBL: ENSMUSP00000144126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]
Predicted Effect probably benign
Transcript: ENSMUST00000043815
AA Change: D1075E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: D1075E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Nup192 14 1684 N/A PFAM
low complexity region 1995 2005 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170234
SMART Domains Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

DomainStartEndE-ValueType
Pfam:DUF3414 13 322 9.7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201374
AA Change: D1128E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: D1128E

DomainStartEndE-ValueType
low complexity region 36 50 N/A INTRINSIC
Pfam:Nup192 67 1737 N/A PFAM
low complexity region 2048 2058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201842
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Nup205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nup205 APN 6 35214802 missense probably damaging 1.00
IGL01086:Nup205 APN 6 35208936 splice site probably benign
IGL01138:Nup205 APN 6 35208084 nonsense probably null
IGL01333:Nup205 APN 6 35241063 missense probably benign
IGL01399:Nup205 APN 6 35219689 missense possibly damaging 0.80
IGL01466:Nup205 APN 6 35199959 missense probably benign 0.08
IGL01913:Nup205 APN 6 35227430 missense probably benign 0.10
IGL02159:Nup205 APN 6 35189178 missense probably damaging 1.00
IGL02442:Nup205 APN 6 35190068 missense probably benign 0.01
IGL02447:Nup205 APN 6 35227576 splice site probably null
IGL02558:Nup205 APN 6 35189924 missense probably damaging 1.00
IGL03306:Nup205 APN 6 35208169 missense probably damaging 0.98
IGL03328:Nup205 APN 6 35232414 missense probably damaging 0.99
Figaro UTSW 6 35196714 splice site probably null
spirit UTSW 6 35232408 missense probably damaging 0.98
Susanna UTSW 6 35208109 missense possibly damaging 0.94
voyager UTSW 6 35189885 missense possibly damaging 0.80
P0012:Nup205 UTSW 6 35196543 missense possibly damaging 0.90
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0362:Nup205 UTSW 6 35196714 splice site probably null
R0374:Nup205 UTSW 6 35208837 missense probably damaging 1.00
R0415:Nup205 UTSW 6 35214634 splice site probably benign
R0427:Nup205 UTSW 6 35194463 missense probably benign 0.01
R0543:Nup205 UTSW 6 35198969 missense probably benign
R0611:Nup205 UTSW 6 35225968 missense probably null 1.00
R0761:Nup205 UTSW 6 35196428 splice site probably benign
R0828:Nup205 UTSW 6 35194566 missense probably benign
R0906:Nup205 UTSW 6 35236892 missense probably damaging 1.00
R1023:Nup205 UTSW 6 35234706 missense probably damaging 0.98
R1033:Nup205 UTSW 6 35227442 missense probably benign
R1375:Nup205 UTSW 6 35200071 splice site probably benign
R1447:Nup205 UTSW 6 35215185 missense probably benign 0.00
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1625:Nup205 UTSW 6 35191943 missense probably benign 0.31
R1652:Nup205 UTSW 6 35238966 missense probably benign
R1659:Nup205 UTSW 6 35234788 missense probably benign 0.02
R1693:Nup205 UTSW 6 35210971 missense probably benign 0.05
R1769:Nup205 UTSW 6 35205431 missense probably damaging 1.00
R1959:Nup205 UTSW 6 35233366 missense probably benign 0.16
R2051:Nup205 UTSW 6 35230516 missense probably benign 0.34
R2267:Nup205 UTSW 6 35241349 missense possibly damaging 0.67
R2401:Nup205 UTSW 6 35208134 nonsense probably null
R3697:Nup205 UTSW 6 35188711 missense probably benign 0.15
R3938:Nup205 UTSW 6 35219742 missense probably damaging 1.00
R4074:Nup205 UTSW 6 35192040 critical splice donor site probably null
R4117:Nup205 UTSW 6 35241012 nonsense probably null
R4364:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4366:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4594:Nup205 UTSW 6 35196489 missense probably benign 0.00
R4706:Nup205 UTSW 6 35202008 missense probably damaging 1.00
R4787:Nup205 UTSW 6 35202061 missense probably damaging 1.00
R4849:Nup205 UTSW 6 35230570 missense possibly damaging 0.90
R4850:Nup205 UTSW 6 35230530 missense probably benign 0.16
R4943:Nup205 UTSW 6 35224639 missense probably damaging 1.00
R4966:Nup205 UTSW 6 35243849 missense probably benign 0.00
R5138:Nup205 UTSW 6 35225866 missense probably damaging 1.00
R5251:Nup205 UTSW 6 35196482 intron probably null
R5444:Nup205 UTSW 6 35189189 missense probably damaging 0.98
R5760:Nup205 UTSW 6 35247343 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35227680 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35230548 missense probably damaging 0.96
R5941:Nup205 UTSW 6 35232408 missense probably damaging 0.98
R5969:Nup205 UTSW 6 35177578 unclassified probably benign
R6003:Nup205 UTSW 6 35212816 missense probably benign
R6178:Nup205 UTSW 6 35243843 missense possibly damaging 0.85
R6315:Nup205 UTSW 6 35236869 missense probably damaging 1.00
R6392:Nup205 UTSW 6 35189885 missense possibly damaging 0.80
R6710:Nup205 UTSW 6 35247373 missense probably benign 0.00
R6954:Nup205 UTSW 6 35208109 missense possibly damaging 0.94
R7022:Nup205 UTSW 6 35243936 missense probably benign 0.45
R7041:Nup205 UTSW 6 35224535 missense possibly damaging 0.49
R7052:Nup205 UTSW 6 35215142 missense possibly damaging 0.81
R7310:Nup205 UTSW 6 35225969 missense possibly damaging 0.78
R7363:Nup205 UTSW 6 35232573 missense probably benign 0.28
R7399:Nup205 UTSW 6 35214676 missense probably damaging 0.99
R7428:Nup205 UTSW 6 35227559 missense probably damaging 1.00
R7553:Nup205 UTSW 6 35201999 missense probably damaging 1.00
R7665:Nup205 UTSW 6 35177620 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AATGTCAGTACTCTTAGCTGTGTTC -3'
(R):5'- TCCCAAGTCAAAAGGGATTGAG -3'

Sequencing Primer
(F):5'- TTAAGAGCACTCACTGGCTG -3'
(R):5'- TATGCCTGTAATTCCAGCCAAGG -3'
Posted On2014-06-23