Incidental Mutation 'R1839:Robo3'
ID 205605
Institutional Source Beutler Lab
Gene Symbol Robo3
Ensembl Gene ENSMUSG00000032128
Gene Name roundabout guidance receptor 3
Synonyms Robo3a, Rbig1, Rig1, Rig-1, Robo3b
MMRRC Submission 045015-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1839 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 37327341-37344730 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37333623 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 696 (V696A)
Ref Sequence ENSEMBL: ENSMUSP00000110690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000115038] [ENSMUST00000170512]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034643
AA Change: V674A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128
AA Change: V674A

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115038
AA Change: V696A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128
AA Change: V696A

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167216
Predicted Effect probably benign
Transcript: ENSMUST00000170512
AA Change: V674A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171467
Meta Mutation Damage Score 0.0842 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal commissural axon growth, and fragile floor plates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,369 (GRCm39) T403A probably damaging Het
Acat3 T A 17: 13,147,493 (GRCm39) R175* probably null Het
Adam1b C A 5: 121,639,104 (GRCm39) C647F probably damaging Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adcy2 C T 13: 68,837,380 (GRCm39) probably null Het
Adcy5 A T 16: 35,069,310 (GRCm39) N426I probably damaging Het
Adgre1 T C 17: 57,748,299 (GRCm39) S500P probably benign Het
Aloxe3 A G 11: 69,020,911 (GRCm39) Y212C probably damaging Het
Ap3d1 A G 10: 80,562,942 (GRCm39) S180P probably damaging Het
Arhgap20 C T 9: 51,760,626 (GRCm39) R790W probably damaging Het
Atp8b4 C A 2: 126,203,702 (GRCm39) A757S possibly damaging Het
Begain G A 12: 109,001,249 (GRCm39) probably benign Het
Ccdc141 T C 2: 76,842,009 (GRCm39) E1474G probably benign Het
Ccdc88b A G 19: 6,831,477 (GRCm39) probably benign Het
Ccnk A G 12: 108,161,333 (GRCm39) T195A probably damaging Het
Cd55b C A 1: 130,341,842 (GRCm39) C265F probably damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Cenpt T C 8: 106,575,646 (GRCm39) S190G possibly damaging Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Cxxc4 C A 3: 133,946,414 (GRCm39) H332N probably damaging Het
Cyp24a1 T C 2: 170,338,661 (GRCm39) I12V probably benign Het
Cyp3a57 T A 5: 145,318,111 (GRCm39) L364Q probably damaging Het
Ddi2 T C 4: 141,440,837 (GRCm39) I47V probably benign Het
Ddx5 A T 11: 106,675,723 (GRCm39) D322E probably benign Het
Dhx40 A G 11: 86,680,123 (GRCm39) C405R possibly damaging Het
Emc1 T C 4: 139,087,796 (GRCm39) F100S probably damaging Het
Exoc2 T C 13: 31,090,480 (GRCm39) probably benign Het
Gm10110 A T 14: 90,135,272 (GRCm39) noncoding transcript Het
Gm17332 T C 11: 31,132,386 (GRCm39) H26R possibly damaging Het
Gna12 T C 5: 140,748,367 (GRCm39) N183S probably benign Het
Gpx6 A G 13: 21,496,497 (GRCm39) N24D probably benign Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Hsd3b5 T C 3: 98,527,044 (GRCm39) Y134C probably benign Het
Ifi213 T C 1: 173,417,166 (GRCm39) I415M probably damaging Het
Ints9 C A 14: 65,253,979 (GRCm39) P278T probably damaging Het
Krt79 C T 15: 101,846,373 (GRCm39) E192K possibly damaging Het
Lrrk2 A G 15: 91,567,337 (GRCm39) N132S probably benign Het
Ltn1 T A 16: 87,213,152 (GRCm39) K470* probably null Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Mcm9 A G 10: 53,417,649 (GRCm39) M18T probably damaging Het
Med12l A G 3: 58,975,740 (GRCm39) T212A probably benign Het
Mfhas1 T C 8: 36,058,012 (GRCm39) L829P possibly damaging Het
Mgme1 T A 2: 144,121,407 (GRCm39) C288S probably benign Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Nme4 A T 17: 26,311,071 (GRCm39) W165R probably damaging Het
Nup205 T A 6: 35,196,649 (GRCm39) D1128E probably benign Het
Or2t48 A T 11: 58,420,199 (GRCm39) Y204* probably null Het
Or5ae2 T C 7: 84,505,756 (GRCm39) Y60H probably damaging Het
Pcdh1 T C 18: 38,332,538 (GRCm39) D155G possibly damaging Het
Pex12 A T 11: 83,188,648 (GRCm39) S116T probably damaging Het
Plekhh1 C T 12: 79,125,731 (GRCm39) probably benign Het
Plekhh3 A G 11: 101,054,426 (GRCm39) probably benign Het
Pnpt1 T C 11: 29,104,342 (GRCm39) M572T possibly damaging Het
Ppp1r12b T C 1: 134,765,719 (GRCm39) R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rgs14 T C 13: 55,530,651 (GRCm39) probably benign Het
Rhbdf2 A T 11: 116,491,017 (GRCm39) V645E possibly damaging Het
Sall1 A G 8: 89,755,344 (GRCm39) F1212L possibly damaging Het
Sdc4 T C 2: 164,270,932 (GRCm39) E109G probably benign Het
Serpind1 G T 16: 17,160,856 (GRCm39) R462L probably damaging Het
Smad9 CTTT CTT 3: 54,696,600 (GRCm39) probably benign Het
Sstr4 C A 2: 148,237,453 (GRCm39) N21K probably benign Het
Tap1 C T 17: 34,407,083 (GRCm39) A77V possibly damaging Het
Thap4 T C 1: 93,678,009 (GRCm39) E259G probably benign Het
Thra A G 11: 98,646,969 (GRCm39) N30S probably benign Het
Tmem207 A T 16: 26,343,571 (GRCm39) V27E possibly damaging Het
Top3a A G 11: 60,644,714 (GRCm39) V305A probably damaging Het
Trim59 A T 3: 68,944,971 (GRCm39) I123K probably damaging Het
Ttn T C 2: 76,691,839 (GRCm39) probably benign Het
Ubac1 T A 2: 25,897,750 (GRCm39) E290V possibly damaging Het
Unc13b T C 4: 43,258,308 (GRCm39) probably benign Het
Uri1 A T 7: 37,666,814 (GRCm39) D206E probably benign Het
Utp4 A G 8: 107,640,086 (GRCm39) H465R probably benign Het
Uvssa T C 5: 33,547,096 (GRCm39) S221P probably benign Het
Vmn1r39 T C 6: 66,782,217 (GRCm39) probably null Het
Vps39 A T 2: 120,155,878 (GRCm39) L514H probably damaging Het
Vps72 G A 3: 95,026,529 (GRCm39) R158Q possibly damaging Het
Wdr59 T C 8: 112,211,972 (GRCm39) D366G probably benign Het
Zfp366 C A 13: 99,365,000 (GRCm39) Q54K probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Robo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Robo3 APN 9 37,339,050 (GRCm39) critical splice donor site probably null
IGL01023:Robo3 APN 9 37,340,847 (GRCm39) missense probably damaging 1.00
IGL01431:Robo3 APN 9 37,330,407 (GRCm39) unclassified probably benign
IGL01993:Robo3 APN 9 37,335,949 (GRCm39) missense probably damaging 1.00
IGL02256:Robo3 APN 9 37,336,649 (GRCm39) missense probably damaging 1.00
IGL02323:Robo3 APN 9 37,333,497 (GRCm39) missense probably benign 0.05
IGL02561:Robo3 APN 9 37,338,387 (GRCm39) missense possibly damaging 0.84
IGL02866:Robo3 APN 9 37,333,602 (GRCm39) missense possibly damaging 0.89
IGL02897:Robo3 APN 9 37,338,798 (GRCm39) nonsense probably null
IGL03003:Robo3 APN 9 37,330,587 (GRCm39) missense probably damaging 1.00
IGL03307:Robo3 APN 9 37,333,860 (GRCm39) missense probably damaging 0.96
IGL03097:Robo3 UTSW 9 37,333,824 (GRCm39) critical splice donor site probably null
R0137:Robo3 UTSW 9 37,336,640 (GRCm39) missense probably benign 0.00
R0266:Robo3 UTSW 9 37,333,936 (GRCm39) missense probably damaging 0.96
R0390:Robo3 UTSW 9 37,333,473 (GRCm39) missense probably benign 0.00
R0505:Robo3 UTSW 9 37,328,055 (GRCm39) unclassified probably benign
R0815:Robo3 UTSW 9 37,333,479 (GRCm39) missense probably damaging 1.00
R0924:Robo3 UTSW 9 37,340,778 (GRCm39) splice site probably benign
R1167:Robo3 UTSW 9 37,335,203 (GRCm39) nonsense probably null
R1203:Robo3 UTSW 9 37,329,978 (GRCm39) missense probably damaging 1.00
R1451:Robo3 UTSW 9 37,329,007 (GRCm39) missense probably benign 0.01
R1575:Robo3 UTSW 9 37,340,957 (GRCm39) missense probably damaging 1.00
R1596:Robo3 UTSW 9 37,335,928 (GRCm39) critical splice donor site probably null
R1660:Robo3 UTSW 9 37,340,440 (GRCm39) missense probably damaging 1.00
R1677:Robo3 UTSW 9 37,329,005 (GRCm39) missense possibly damaging 0.75
R1878:Robo3 UTSW 9 37,333,461 (GRCm39) missense probably damaging 1.00
R1891:Robo3 UTSW 9 37,339,351 (GRCm39) missense probably damaging 1.00
R2040:Robo3 UTSW 9 37,338,760 (GRCm39) missense probably damaging 1.00
R2859:Robo3 UTSW 9 37,339,400 (GRCm39) nonsense probably null
R3786:Robo3 UTSW 9 37,333,521 (GRCm39) missense probably damaging 1.00
R3886:Robo3 UTSW 9 37,333,477 (GRCm39) nonsense probably null
R3888:Robo3 UTSW 9 37,333,477 (GRCm39) nonsense probably null
R3910:Robo3 UTSW 9 37,330,591 (GRCm39) missense probably damaging 1.00
R4212:Robo3 UTSW 9 37,333,194 (GRCm39) missense probably damaging 1.00
R4213:Robo3 UTSW 9 37,333,194 (GRCm39) missense probably damaging 1.00
R4691:Robo3 UTSW 9 37,336,514 (GRCm39) missense probably damaging 0.99
R4979:Robo3 UTSW 9 37,334,640 (GRCm39) missense probably damaging 1.00
R5238:Robo3 UTSW 9 37,328,175 (GRCm39) missense probably damaging 0.99
R5570:Robo3 UTSW 9 37,336,571 (GRCm39) missense possibly damaging 0.81
R5629:Robo3 UTSW 9 37,330,507 (GRCm39) nonsense probably null
R5770:Robo3 UTSW 9 37,330,497 (GRCm39) missense possibly damaging 0.87
R5837:Robo3 UTSW 9 37,341,112 (GRCm39) critical splice acceptor site probably null
R6021:Robo3 UTSW 9 37,333,829 (GRCm39) nonsense probably null
R6129:Robo3 UTSW 9 37,334,589 (GRCm39) missense probably benign
R6232:Robo3 UTSW 9 37,332,225 (GRCm39) missense probably damaging 1.00
R6233:Robo3 UTSW 9 37,332,225 (GRCm39) missense probably damaging 1.00
R6235:Robo3 UTSW 9 37,332,225 (GRCm39) missense probably damaging 1.00
R6326:Robo3 UTSW 9 37,338,323 (GRCm39) missense probably damaging 1.00
R6354:Robo3 UTSW 9 37,328,513 (GRCm39) unclassified probably benign
R6355:Robo3 UTSW 9 37,330,235 (GRCm39) missense possibly damaging 0.71
R6475:Robo3 UTSW 9 37,334,586 (GRCm39) missense probably damaging 0.99
R6937:Robo3 UTSW 9 37,341,176 (GRCm39) missense probably benign 0.16
R7201:Robo3 UTSW 9 37,335,626 (GRCm39) nonsense probably null
R7208:Robo3 UTSW 9 37,336,020 (GRCm39) missense probably damaging 0.99
R7249:Robo3 UTSW 9 37,336,129 (GRCm39) missense probably benign
R7376:Robo3 UTSW 9 37,344,212 (GRCm39) missense probably damaging 1.00
R7380:Robo3 UTSW 9 37,329,852 (GRCm39) missense probably damaging 1.00
R7448:Robo3 UTSW 9 37,336,111 (GRCm39) missense possibly damaging 0.89
R7475:Robo3 UTSW 9 37,336,674 (GRCm39) missense probably benign 0.01
R7496:Robo3 UTSW 9 37,339,121 (GRCm39) missense probably damaging 1.00
R7587:Robo3 UTSW 9 37,340,942 (GRCm39) missense probably damaging 1.00
R7694:Robo3 UTSW 9 37,329,816 (GRCm39) missense probably benign 0.14
R8381:Robo3 UTSW 9 37,341,056 (GRCm39) missense probably damaging 1.00
R8464:Robo3 UTSW 9 37,332,726 (GRCm39) missense probably damaging 1.00
R8495:Robo3 UTSW 9 37,336,664 (GRCm39) missense probably damaging 1.00
R8886:Robo3 UTSW 9 37,328,768 (GRCm39) missense probably damaging 0.99
R9422:Robo3 UTSW 9 37,329,789 (GRCm39) missense probably benign 0.03
R9563:Robo3 UTSW 9 37,340,900 (GRCm39) missense probably damaging 1.00
R9564:Robo3 UTSW 9 37,340,900 (GRCm39) missense probably damaging 1.00
R9681:Robo3 UTSW 9 37,339,087 (GRCm39) missense probably benign 0.45
R9681:Robo3 UTSW 9 37,334,558 (GRCm39) missense possibly damaging 0.75
X0024:Robo3 UTSW 9 37,339,151 (GRCm39) missense probably damaging 1.00
X0027:Robo3 UTSW 9 37,339,121 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTTACCCTCCTCAGGAATG -3'
(R):5'- CGGTTAGAAATGGCATGGCG -3'

Sequencing Primer
(F):5'- CTGGTCACAAAAGGGCTTTC -3'
(R):5'- TTAGAAATGGCATGGCGATGGG -3'
Posted On 2014-06-23