Incidental Mutation 'R1839:Col6a5'
Institutional Source Beutler Lab
Gene Symbol Col6a5
Ensembl Gene ENSMUSG00000091345
Gene Namecollagen, type VI, alpha 5
SynonymsGm7455, Col6a5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R1839 (G1)
Quality Score225
Status Validated
Chromosomal Location105856078-105960643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105864833 bp
Amino Acid Change Histidine to Tyrosine at position 2296 (H2296Y)
Ref Sequence ENSEMBL: ENSMUSP00000139398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165165] [ENSMUST00000190193]
Predicted Effect probably benign
Transcript: ENSMUST00000165165
AA Change: H2296Y

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131146
Gene: ENSMUSG00000091345
AA Change: H2296Y

signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.8e-24 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 2.23e-20 SMART
VWA 472 649 6.84e-39 SMART
VWA 658 834 1.52e-45 SMART
VWA 844 1024 2.44e-44 SMART
VWA 1035 1208 2.95e-20 SMART
Pfam:Collagen 1425 1478 3.3e-8 PFAM
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 9.6e-10 PFAM
low complexity region 1711 1730 N/A INTRINSIC
low complexity region 1739 1757 N/A INTRINSIC
VWA 1788 1964 1.99e-17 SMART
VWA 1994 2173 5.98e-21 SMART
VWA 2319 2513 4.4e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190193
AA Change: H2296Y

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139398
Gene: ENSMUSG00000091345
AA Change: H2296Y

signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.1e-26 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 1.4e-22 SMART
VWA 472 649 4.4e-41 SMART
VWA 658 834 9.5e-48 SMART
VWA 844 1024 1.6e-46 SMART
VWA 1035 1208 1.9e-22 SMART
Pfam:Collagen 1425 1478 1.2e-6 PFAM
Pfam:Collagen 1457 1530 5.9e-6 PFAM
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 3.6e-8 PFAM
Pfam:Collagen 1631 1691 8.4e-6 PFAM
Pfam:Collagen 1706 1764 6.6e-6 PFAM
VWA 1788 1964 1.2e-19 SMART
VWA 1994 2173 3.7e-23 SMART
VWA 2319 2513 2.8e-21 SMART
Meta Mutation Damage Score 0.0796 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Col6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Col6a5 APN 9 105882683 missense probably damaging 1.00
IGL01462:Col6a5 APN 9 105946075 missense unknown
IGL01530:Col6a5 APN 9 105915186 splice site probably benign
IGL01717:Col6a5 APN 9 105940273 missense unknown
IGL01859:Col6a5 APN 9 105930961 nonsense probably null
IGL01945:Col6a5 APN 9 105928290 missense unknown
IGL01985:Col6a5 APN 9 105937283 missense unknown
IGL02128:Col6a5 APN 9 105939894 missense unknown
IGL02170:Col6a5 APN 9 105928422 missense unknown
IGL02224:Col6a5 APN 9 105864335 missense probably damaging 1.00
IGL02246:Col6a5 APN 9 105911107 nonsense probably null
IGL02304:Col6a5 APN 9 105928414 missense unknown
IGL02338:Col6a5 APN 9 105878630 missense probably damaging 1.00
IGL02375:Col6a5 APN 9 105906113 missense unknown
IGL02660:Col6a5 APN 9 105936886 missense unknown
IGL02829:Col6a5 APN 9 105934307 missense unknown
IGL02882:Col6a5 APN 9 105934321 missense unknown
IGL02973:Col6a5 APN 9 105925821 missense unknown
IGL03089:Col6a5 APN 9 105933839 missense unknown
IGL03100:Col6a5 APN 9 105937313 missense unknown
IGL03257:Col6a5 APN 9 105881873 missense possibly damaging 0.95
FR4340:Col6a5 UTSW 9 105934174 missense unknown
FR4342:Col6a5 UTSW 9 105934174 missense unknown
FR4589:Col6a5 UTSW 9 105934174 missense unknown
PIT4131001:Col6a5 UTSW 9 105881914 missense probably damaging 0.98
R0147:Col6a5 UTSW 9 105925794 missense unknown
R0549:Col6a5 UTSW 9 105904579 splice site probably benign
R0622:Col6a5 UTSW 9 105925852 missense unknown
R0628:Col6a5 UTSW 9 105912450 splice site probably null
R0635:Col6a5 UTSW 9 105928606 missense unknown
R0644:Col6a5 UTSW 9 105948324 critical splice donor site probably null
R0828:Col6a5 UTSW 9 105862064 critical splice acceptor site probably null
R0972:Col6a5 UTSW 9 105940285 missense unknown
R1065:Col6a5 UTSW 9 105881783 missense probably damaging 0.99
R1142:Col6a5 UTSW 9 105934317 missense unknown
R1169:Col6a5 UTSW 9 105896974 splice site probably null
R1522:Col6a5 UTSW 9 105939994 missense unknown
R1646:Col6a5 UTSW 9 105862749 nonsense probably null
R1719:Col6a5 UTSW 9 105931293 missense unknown
R1759:Col6a5 UTSW 9 105930846 missense unknown
R1780:Col6a5 UTSW 9 105936878 missense unknown
R1812:Col6a5 UTSW 9 105928054 missense unknown
R1838:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1863:Col6a5 UTSW 9 105940201 missense unknown
R1900:Col6a5 UTSW 9 105931213 missense unknown
R1951:Col6a5 UTSW 9 105936957 missense unknown
R2024:Col6a5 UTSW 9 105936994 missense unknown
R2126:Col6a5 UTSW 9 105945600 missense unknown
R2319:Col6a5 UTSW 9 105937218 missense unknown
R2344:Col6a5 UTSW 9 105928537 missense unknown
R2483:Col6a5 UTSW 9 105864148 missense probably damaging 1.00
R3176:Col6a5 UTSW 9 105911107 nonsense probably null
R3276:Col6a5 UTSW 9 105911107 nonsense probably null
R3438:Col6a5 UTSW 9 105875792 missense possibly damaging 0.88
R3791:Col6a5 UTSW 9 105864669 missense probably damaging 0.99
R3840:Col6a5 UTSW 9 105928611 missense unknown
R3886:Col6a5 UTSW 9 105930930 missense unknown
R3941:Col6a5 UTSW 9 105939834 missense unknown
R4194:Col6a5 UTSW 9 105945914 missense unknown
R4399:Col6a5 UTSW 9 105888965 missense possibly damaging 0.75
R4421:Col6a5 UTSW 9 105928473 missense unknown
R4450:Col6a5 UTSW 9 105904521 missense unknown
R4491:Col6a5 UTSW 9 105940012 missense unknown
R4582:Col6a5 UTSW 9 105862764 missense probably benign 0.17
R4693:Col6a5 UTSW 9 105937172 missense unknown
R4787:Col6a5 UTSW 9 105931081 missense unknown
R4789:Col6a5 UTSW 9 105937335 missense unknown
R4791:Col6a5 UTSW 9 105930784 missense unknown
R4792:Col6a5 UTSW 9 105930784 missense unknown
R4817:Col6a5 UTSW 9 105934298 missense unknown
R4854:Col6a5 UTSW 9 105898751 missense probably benign 0.18
R4927:Col6a5 UTSW 9 105933964 missense unknown
R4969:Col6a5 UTSW 9 105864607 missense probably damaging 1.00
R5037:Col6a5 UTSW 9 105928138 missense unknown
R5118:Col6a5 UTSW 9 105937005 missense unknown
R5144:Col6a5 UTSW 9 105889283 missense probably damaging 1.00
R5145:Col6a5 UTSW 9 105934245 missense unknown
R5160:Col6a5 UTSW 9 105931009 missense unknown
R5182:Col6a5 UTSW 9 105857332 nonsense probably null
R5234:Col6a5 UTSW 9 105864205 missense probably damaging 1.00
R5252:Col6a5 UTSW 9 105940290 missense unknown
R5290:Col6a5 UTSW 9 105946083 missense unknown
R5313:Col6a5 UTSW 9 105945544 missense unknown
R5321:Col6a5 UTSW 9 105928465 missense unknown
R5466:Col6a5 UTSW 9 105931083 missense unknown
R5540:Col6a5 UTSW 9 105862776 missense probably benign 0.44
R5669:Col6a5 UTSW 9 105925998 missense unknown
R5789:Col6a5 UTSW 9 105864608 missense possibly damaging 0.91
R5801:Col6a5 UTSW 9 105948367 missense unknown
R5827:Col6a5 UTSW 9 105928120 nonsense probably null
R5839:Col6a5 UTSW 9 105945393 critical splice donor site probably null
R5908:Col6a5 UTSW 9 105862801 missense possibly damaging 0.88
R5970:Col6a5 UTSW 9 105945847 missense unknown
R6045:Col6a5 UTSW 9 105925918 missense unknown
R6107:Col6a5 UTSW 9 105892272 nonsense probably null
R6168:Col6a5 UTSW 9 105875787 critical splice donor site probably null
R6315:Col6a5 UTSW 9 105881970 missense probably damaging 1.00
R6317:Col6a5 UTSW 9 105889067 missense probably damaging 1.00
R6414:Col6a5 UTSW 9 105892266 splice site probably null
R6434:Col6a5 UTSW 9 105937345 missense unknown
R6456:Col6a5 UTSW 9 105945477 missense unknown
R6698:Col6a5 UTSW 9 105934175 missense unknown
R6876:Col6a5 UTSW 9 105937307 missense unknown
R6882:Col6a5 UTSW 9 105940270 nonsense probably null
R6928:Col6a5 UTSW 9 105939919 missense unknown
R7024:Col6a5 UTSW 9 105912475 nonsense probably null
R7038:Col6a5 UTSW 9 105945738 missense unknown
R7082:Col6a5 UTSW 9 105931239 missense unknown
R7158:Col6a5 UTSW 9 105864208 missense possibly damaging 0.90
R7211:Col6a5 UTSW 9 105928164 missense unknown
R7431:Col6a5 UTSW 9 105928269 missense unknown
R7440:Col6a5 UTSW 9 105881431 nonsense probably null
R7502:Col6a5 UTSW 9 105875876 missense probably benign 0.05
R7577:Col6a5 UTSW 9 105864688 nonsense probably null
R7582:Col6a5 UTSW 9 105945426 missense unknown
R7641:Col6a5 UTSW 9 105881426 nonsense probably null
R7762:Col6a5 UTSW 9 105931324 missense unknown
R7793:Col6a5 UTSW 9 105898735 missense probably damaging 1.00
R7821:Col6a5 UTSW 9 105864259 missense probably damaging 1.00
R7848:Col6a5 UTSW 9 105928186 missense unknown
R7897:Col6a5 UTSW 9 105889183 missense possibly damaging 0.96
R7904:Col6a5 UTSW 9 105928521 missense unknown
R7931:Col6a5 UTSW 9 105928186 missense unknown
R7980:Col6a5 UTSW 9 105889183 missense possibly damaging 0.96
R7987:Col6a5 UTSW 9 105928521 missense unknown
RF013:Col6a5 UTSW 9 105878597 frame shift probably null
X0054:Col6a5 UTSW 9 105915158 missense unknown
X0058:Col6a5 UTSW 9 105881778 nonsense probably null
Z1088:Col6a5 UTSW 9 105926067 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-06-23