Mutagenetix > Incidental Mutation

Incidental Mutation 'R1839:Celsr3'

205612

Institutional Source

Beutler Lab

Gene Symbol

Celsr3

Ensembl Gene

ENSMUSG00000023473

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 3

Synonyms

Fmi1, flamingo

MMRRC Submission

045015-MU

Accession Numbers

Genbank: NM_080437; MGI: 1858236

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1839 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108826320-108852969 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108829906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1196 (H1196R)

Ref Sequence

ENSEMBL: ENSMUSP00000150759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192235] [ENSMUST00000213524]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000024238
AA Change: H1196R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: H1196R

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	264	293	N/A	INTRINSIC
CA	338	422	2.25e-27	SMART
CA	446	534	5.05e-30	SMART
CA	558	640	7.6e-25	SMART
CA	664	745	7.36e-32	SMART
CA	769	847	5.95e-18	SMART
CA	871	950	5.25e-28	SMART
CA	974	1056	2.67e-29	SMART
CA	1080	1158	1.18e-21	SMART
CA	1186	1262	3.2e-1	SMART
low complexity region	1328	1335	N/A	INTRINSIC
low complexity region	1350	1360	N/A	INTRINSIC
EGF	1369	1424	1.02e-2	SMART
EGF	1429	1464	3.23e0	SMART
EGF	1467	1503	8.78e-2	SMART
LamG	1524	1691	2.27e-35	SMART
EGF	1714	1747	4.22e-4	SMART
LamG	1774	1913	9.02e-21	SMART
EGF	1938	1971	2.43e-4	SMART
EGF	1973	2009	1.3e-4	SMART
EGF_Lam	2066	2111	5.08e-7	SMART
HormR	2114	2176	3.42e-21	SMART
Pfam:GAIN	2188	2441	1.1e-57	PFAM
GPS	2467	2520	7.92e-20	SMART
Pfam:7tm_2	2527	2758	1.5e-56	PFAM
low complexity region	2813	2829	N/A	INTRINSIC
low complexity region	2882	2906	N/A	INTRINSIC
low complexity region	3058	3072	N/A	INTRINSIC
low complexity region	3149	3189	N/A	INTRINSIC
low complexity region	3239	3261	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192235

SMART Domains

Protein: ENSMUSP00000141429
Gene: ENSMUSG00000023473

Domain	Start	End	E-Value	Type
low complexity region	67	74	N/A	INTRINSIC
low complexity region	89	99	N/A	INTRINSIC
EGF	108	163	4.9e-5	SMART
EGF	168	201	2.6e-6	SMART
EGF_like	208	239	1.6e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193114

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194742

Predicted Effect

probably benign
Transcript: ENSMUST00000213524
AA Change: H1196R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0881

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.7%
20x: 90.6%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	C	3: 124,409,720	T403A	probably damaging	Het
Acat3	T	A	17: 12,928,606	R175*	probably null	Het
Adam1b	C	A	5: 121,501,041	C647F	probably damaging	Het
Adam28	T	C	14: 68,639,210	N197S	possibly damaging	Het
Adcy2	C	T	13: 68,689,261		probably null	Het
Adcy5	A	T	16: 35,248,940	N426I	probably damaging	Het
Adgre1	T	C	17: 57,441,299	S500P	probably benign	Het
Aloxe3	A	G	11: 69,130,085	Y212C	probably damaging	Het
Ap3d1	A	G	10: 80,727,108	S180P	probably damaging	Het
Arhgap20	C	T	9: 51,849,326	R790W	probably damaging	Het
Atp8b4	C	A	2: 126,361,782	A757S	possibly damaging	Het
Begain	G	A	12: 109,035,323		probably benign	Het
Ccdc141	T	C	2: 77,011,665	E1474G	probably benign	Het
Ccdc88b	A	G	19: 6,854,109		probably benign	Het
Ccnk	A	G	12: 108,195,074	T195A	probably damaging	Het
Cd55b	C	A	1: 130,414,105	C265F	probably damaging	Het
Cenpt	T	C	8: 105,849,014	S190G	possibly damaging	Het
Chd8	T	C	14: 52,204,883	S2077G	probably benign	Het
Col6a5	G	A	9: 105,864,833	H2296Y	probably benign	Het
Cxxc4	C	A	3: 134,240,653	H332N	probably damaging	Het
Cyp24a1	T	C	2: 170,496,741	I12V	probably benign	Het
Cyp3a57	T	A	5: 145,381,301	L364Q	probably damaging	Het
Ddi2	T	C	4: 141,713,526	I47V	probably benign	Het
Ddx5	A	T	11: 106,784,897	D322E	probably benign	Het
Dhx40	A	G	11: 86,789,297	C405R	possibly damaging	Het
Emc1	T	C	4: 139,360,485	F100S	probably damaging	Het
Exoc2	T	C	13: 30,906,497		probably benign	Het
Gm10110	A	T	14: 89,897,836		noncoding transcript	Het
Gm17332	T	C	11: 31,182,386	H26R	possibly damaging	Het
Gna12	T	C	5: 140,762,612	N183S	probably benign	Het
Gpx6	A	G	13: 21,312,327	N24D	probably benign	Het
Gsdma3	C	T	11: 98,629,858	A105V	probably benign	Het
Hsd3b5	T	C	3: 98,619,728	Y134C	probably benign	Het
Ifi213	T	C	1: 173,589,600	I415M	probably damaging	Het
Ints9	C	A	14: 65,016,530	P278T	probably damaging	Het
Krt79	C	T	15: 101,937,938	E192K	possibly damaging	Het
Lrrk2	A	G	15: 91,683,134	N132S	probably benign	Het
Ltn1	T	A	16: 87,416,264	K470*	probably null	Het
Magi2	A	T	5: 20,465,827	T163S	probably damaging	Het
Mcm9	A	G	10: 53,541,553	M18T	probably damaging	Het
Med12l	A	G	3: 59,068,319	T212A	probably benign	Het
Mfhas1	T	C	8: 35,590,858	L829P	possibly damaging	Het
Mgme1	T	A	2: 144,279,487	C288S	probably benign	Het
Muc4	G	C	16: 32,753,919	R1265P	probably benign	Het
Myh7	T	C	14: 54,973,180	N1725S	possibly damaging	Het
Nat6	G	A	9: 107,583,017	R37H	possibly damaging	Het
Nme4	A	T	17: 26,092,097	W165R	probably damaging	Het
Nup205	T	A	6: 35,219,714	D1128E	probably benign	Het
Olfr291	T	C	7: 84,856,548	Y60H	probably damaging	Het
Olfr330	A	T	11: 58,529,373	Y204*	probably null	Het
Pcdh1	T	C	18: 38,199,485	D155G	possibly damaging	Het
Pex12	A	T	11: 83,297,822	S116T	probably damaging	Het
Plekhh1	C	T	12: 79,078,957		probably benign	Het
Plekhh3	A	G	11: 101,163,600		probably benign	Het
Pnpt1	T	C	11: 29,154,342	M572T	possibly damaging	Het
Ppp1r12b	T	C	1: 134,837,981	R667G	probably benign	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rgs14	T	C	13: 55,382,838		probably benign	Het
Rhbdf2	A	T	11: 116,600,191	V645E	possibly damaging	Het
Robo3	A	G	9: 37,422,327	V696A	probably benign	Het
Sall1	A	G	8: 89,028,716	F1212L	possibly damaging	Het
Sdc4	T	C	2: 164,429,012	E109G	probably benign	Het
Serpind1	G	T	16: 17,342,992	R462L	probably damaging	Het
Smad9	CTTT	CTT	3: 54,789,179		probably benign	Het
Sstr4	C	A	2: 148,395,533	N21K	probably benign	Het
Tap1	C	T	17: 34,188,109	A77V	possibly damaging	Het
Thap4	T	C	1: 93,750,287	E259G	probably benign	Het
Thra	A	G	11: 98,756,143	N30S	probably benign	Het
Tmem207	A	T	16: 26,524,821	V27E	possibly damaging	Het
Top3a	A	G	11: 60,753,888	V305A	probably damaging	Het
Trim59	A	T	3: 69,037,638	I123K	probably damaging	Het
Ttn	T	C	2: 76,861,495		probably benign	Het
Ubac1	T	A	2: 26,007,738	E290V	possibly damaging	Het
Unc13b	T	C	4: 43,258,308		probably benign	Het
Uri1	A	T	7: 37,967,389	D206E	probably benign	Het
Utp4	A	G	8: 106,913,454	H465R	probably benign	Het
Uvssa	T	C	5: 33,389,752	S221P	probably benign	Het
Vmn1r39	T	C	6: 66,805,233		probably null	Het
Vps39	A	T	2: 120,325,397	L514H	probably damaging	Het
Vps72	G	A	3: 95,119,218	R158Q	possibly damaging	Het
Wdr59	T	C	8: 111,485,340	D366G	probably benign	Het
Zfp366	C	A	13: 99,228,492	Q54K	probably damaging	Het
Zfp523	T	A	17: 28,194,993	I34N	probably damaging	Het
Zfp974	G	A	7: 27,910,356	P648L	possibly damaging	Het

Other mutations in Celsr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Celsr3	APN	9	108848925	missense	probably damaging	1.00
IGL00536:Celsr3	APN	9	108829192	missense	probably benign	0.33
IGL00552:Celsr3	APN	9	108841263	missense	possibly damaging	0.88
IGL00801:Celsr3	APN	9	108842576	missense	probably benign
IGL01420:Celsr3	APN	9	108841190	critical splice acceptor site	probably null
IGL01541:Celsr3	APN	9	108831708	missense	probably damaging	1.00
IGL01619:Celsr3	APN	9	108834557	missense	probably damaging	1.00
IGL01619:Celsr3	APN	9	108837404	missense	probably benign	0.00
IGL01631:Celsr3	APN	9	108837404	missense	probably benign	0.00
IGL01777:Celsr3	APN	9	108835942	missense	probably benign	0.08
IGL01938:Celsr3	APN	9	108828415	missense	probably benign	0.34
IGL02135:Celsr3	APN	9	108827556	missense	probably benign	0.11
IGL02231:Celsr3	APN	9	108842510	missense	probably damaging	1.00
IGL02234:Celsr3	APN	9	108829960	missense	probably benign
IGL02392:Celsr3	APN	9	108834721	splice site	probably benign
IGL02416:Celsr3	APN	9	108832119	missense	probably damaging	1.00
IGL02421:Celsr3	APN	9	108840463	missense	probably damaging	1.00
IGL02455:Celsr3	APN	9	108842893	missense	probably benign	0.15
IGL02798:Celsr3	APN	9	108843575	missense	probably damaging	1.00
IGL02939:Celsr3	APN	9	108849453	missense	probably damaging	1.00
IGL02947:Celsr3	APN	9	108845935	missense	probably benign	0.12
IGL02986:Celsr3	APN	9	108841255	splice site	probably null
IGL03089:Celsr3	APN	9	108826607	missense	probably benign	0.04
IGL03162:Celsr3	APN	9	108842558	missense	probably damaging	1.00
IGL03267:Celsr3	APN	9	108836525	splice site	probably benign
Diminishment	UTSW	9	108842708	intron	probably benign
little_d	UTSW	9	108827692	missense	probably damaging	0.98
nogal	UTSW	9	108835838	missense	probably benign
F6893:Celsr3	UTSW	9	108835067	missense	probably benign	0.00
PIT4243001:Celsr3	UTSW	9	108832308	missense	probably benign	0.13
PIT4810001:Celsr3	UTSW	9	108845733	missense	probably damaging	1.00
R0110:Celsr3	UTSW	9	108827005	missense	possibly damaging	0.62
R0243:Celsr3	UTSW	9	108843724	splice site	probably benign
R0382:Celsr3	UTSW	9	108829218	missense	probably damaging	1.00
R0482:Celsr3	UTSW	9	108829073	nonsense	probably null
R0510:Celsr3	UTSW	9	108827005	missense	possibly damaging	0.62
R0630:Celsr3	UTSW	9	108827692	missense	probably damaging	0.98
R0656:Celsr3	UTSW	9	108834655	missense	possibly damaging	0.89
R0764:Celsr3	UTSW	9	108827818	missense	probably damaging	1.00
R0883:Celsr3	UTSW	9	108842633	missense	probably damaging	1.00
R0924:Celsr3	UTSW	9	108846025	missense	possibly damaging	0.78
R1015:Celsr3	UTSW	9	108833176	missense	probably benign	0.17
R1321:Celsr3	UTSW	9	108835870	missense	probably damaging	1.00
R1423:Celsr3	UTSW	9	108826905	missense	probably benign	0.00
R1497:Celsr3	UTSW	9	108848865	missense	probably benign	0.14
R1520:Celsr3	UTSW	9	108848658	missense	probably damaging	1.00
R1534:Celsr3	UTSW	9	108848884	missense	probably damaging	0.99
R1569:Celsr3	UTSW	9	108829068	missense	probably damaging	1.00
R1657:Celsr3	UTSW	9	108842952	nonsense	probably null
R1753:Celsr3	UTSW	9	108831857	missense	probably damaging	0.99
R1764:Celsr3	UTSW	9	108828958	missense	probably damaging	1.00
R1801:Celsr3	UTSW	9	108834626	missense	possibly damaging	0.88
R1838:Celsr3	UTSW	9	108829906	missense	probably benign
R1874:Celsr3	UTSW	9	108835838	missense	probably benign
R1875:Celsr3	UTSW	9	108835838	missense	probably benign
R1953:Celsr3	UTSW	9	108843182	missense	probably benign	0.19
R1960:Celsr3	UTSW	9	108845817	missense	probably benign
R2113:Celsr3	UTSW	9	108838470	missense	probably damaging	1.00
R2290:Celsr3	UTSW	9	108843224	missense	probably damaging	1.00
R2369:Celsr3	UTSW	9	108842552	missense	probably benign
R2373:Celsr3	UTSW	9	108842552	missense	probably benign
R2374:Celsr3	UTSW	9	108842552	missense	probably benign
R2375:Celsr3	UTSW	9	108842552	missense	probably benign
R2844:Celsr3	UTSW	9	108829308	missense	probably damaging	1.00
R2968:Celsr3	UTSW	9	108832191	missense	probably damaging	1.00
R3103:Celsr3	UTSW	9	108837139	missense	probably benign	0.31
R3159:Celsr3	UTSW	9	108827710	missense	possibly damaging	0.94
R3791:Celsr3	UTSW	9	108842552	missense	probably benign
R4194:Celsr3	UTSW	9	108843302	critical splice donor site	probably null
R4329:Celsr3	UTSW	9	108846049	missense	probably benign	0.00
R4365:Celsr3	UTSW	9	108829847	missense	possibly damaging	0.47
R4419:Celsr3	UTSW	9	108843244	missense	possibly damaging	0.84
R4484:Celsr3	UTSW	9	108846063	critical splice donor site	probably null
R4582:Celsr3	UTSW	9	108845723	missense	probably damaging	1.00
R4681:Celsr3	UTSW	9	108827754	missense	possibly damaging	0.58
R4729:Celsr3	UTSW	9	108847652	missense	probably benign	0.05
R4881:Celsr3	UTSW	9	108843941	missense	probably damaging	1.00
R4893:Celsr3	UTSW	9	108849421	missense	probably damaging	1.00
R5183:Celsr3	UTSW	9	108837560	missense	probably damaging	0.99
R5207:Celsr3	UTSW	9	108832759	missense	probably benign	0.01
R5290:Celsr3	UTSW	9	108843158	missense	probably benign	0.01
R5327:Celsr3	UTSW	9	108842708	intron	probably benign
R5345:Celsr3	UTSW	9	108832124	missense	probably damaging	1.00
R5358:Celsr3	UTSW	9	108832025	missense	possibly damaging	0.96
R5396:Celsr3	UTSW	9	108828582	missense	probably damaging	1.00
R5414:Celsr3	UTSW	9	108840042	missense	possibly damaging	0.88
R5452:Celsr3	UTSW	9	108844034	missense	possibly damaging	0.68
R5467:Celsr3	UTSW	9	108828637	missense	probably damaging	1.00
R5479:Celsr3	UTSW	9	108844544	critical splice donor site	probably null
R5629:Celsr3	UTSW	9	108849067	missense	probably benign	0.41
R5637:Celsr3	UTSW	9	108837133	missense	probably damaging	1.00
R5652:Celsr3	UTSW	9	108838472	missense	probably benign	0.03
R5739:Celsr3	UTSW	9	108827158	missense	probably benign
R5785:Celsr3	UTSW	9	108827797	missense	probably damaging	1.00
R5877:Celsr3	UTSW	9	108845727	missense	probably damaging	0.98
R5961:Celsr3	UTSW	9	108831794	missense	probably damaging	1.00
R6046:Celsr3	UTSW	9	108837151	missense	probably benign	0.01
R6176:Celsr3	UTSW	9	108828355	missense	probably damaging	1.00
R6291:Celsr3	UTSW	9	108828842	missense	probably damaging	1.00
R6468:Celsr3	UTSW	9	108835790	missense	probably benign	0.08
R6481:Celsr3	UTSW	9	108837084	missense	possibly damaging	0.92
R6547:Celsr3	UTSW	9	108829128	missense	probably damaging	1.00
R6763:Celsr3	UTSW	9	108827350	missense	probably damaging	1.00
R6870:Celsr3	UTSW	9	108829191	missense	probably benign	0.02
R6977:Celsr3	UTSW	9	108827715	missense	probably benign
R7061:Celsr3	UTSW	9	108847594	nonsense	probably null
R7122:Celsr3	UTSW	9	108828567	missense	possibly damaging	0.90
R7156:Celsr3	UTSW	9	108838004	missense	possibly damaging	0.95
R7166:Celsr3	UTSW	9	108842951	missense	probably damaging	1.00
R7176:Celsr3	UTSW	9	108845762	missense	probably benign
R7213:Celsr3	UTSW	9	108849040	missense	probably damaging	0.98
R7314:Celsr3	UTSW	9	108829144	missense	probably damaging	1.00
R7478:Celsr3	UTSW	9	108843578	missense	probably benign	0.37
R7508:Celsr3	UTSW	9	108836622	missense	probably benign
R7554:Celsr3	UTSW	9	108841209	missense	probably benign
R7615:Celsr3	UTSW	9	108837652	missense	possibly damaging	0.75
R7653:Celsr3	UTSW	9	108835070	nonsense	probably null
R7747:Celsr3	UTSW	9	108829978	missense	possibly damaging	0.61
R7881:Celsr3	UTSW	9	108828072	missense	probably benign	0.28
R7935:Celsr3	UTSW	9	108829641	missense	probably benign	0.01
R7995:Celsr3	UTSW	9	108845083	missense	probably damaging	0.99
R8006:Celsr3	UTSW	9	108829107	missense	probably damaging	1.00
R8077:Celsr3	UTSW	9	108828331	missense	probably benign	0.15
R8284:Celsr3	UTSW	9	108846413	missense	probably damaging	0.99
R8291:Celsr3	UTSW	9	108837970	missense	probably damaging	1.00
R8322:Celsr3	UTSW	9	108848794	missense	probably damaging	1.00
R8334:Celsr3	UTSW	9	108841272	frame shift	probably null
R8337:Celsr3	UTSW	9	108841272	frame shift	probably null
R8338:Celsr3	UTSW	9	108827340	nonsense	probably null
R8353:Celsr3	UTSW	9	108826535	missense	probably benign	0.00
R8407:Celsr3	UTSW	9	108829057	missense	probably damaging	1.00
R8408:Celsr3	UTSW	9	108831789	missense	probably damaging	1.00
R8459:Celsr3	UTSW	9	108829630	missense	probably damaging	1.00
R8510:Celsr3	UTSW	9	108838120	missense	possibly damaging	0.93
R8713:Celsr3	UTSW	9	108829863	missense	probably benign
R8728:Celsr3	UTSW	9	108846741	missense	probably benign	0.24
R8829:Celsr3	UTSW	9	108840383	missense	probably benign
R8877:Celsr3	UTSW	9	108829678	missense	probably damaging	1.00
R8905:Celsr3	UTSW	9	108841302	missense	probably damaging	1.00
R9008:Celsr3	UTSW	9	108828952	missense	possibly damaging	0.94
R9072:Celsr3	UTSW	9	108827094	missense	probably benign
R9157:Celsr3	UTSW	9	108829986	missense	probably damaging	1.00
R9183:Celsr3	UTSW	9	108829396	missense	probably damaging	1.00
R9275:Celsr3	UTSW	9	108838490	missense	probably benign	0.27
R9361:Celsr3	UTSW	9	108849322	missense	probably damaging	1.00
R9382:Celsr3	UTSW	9	108829762	missense	possibly damaging	0.60
R9407:Celsr3	UTSW	9	108846397	missense	probably damaging	1.00
R9432:Celsr3	UTSW	9	108848833	missense	probably benign	0.00
R9607:Celsr3	UTSW	9	108840502	critical splice donor site	probably null
R9626:Celsr3	UTSW	9	108849322	missense	probably damaging	1.00
R9628:Celsr3	UTSW	9	108826360	nonsense	probably null
R9630:Celsr3	UTSW	9	108827097	missense	probably benign
R9645:Celsr3	UTSW	9	108827492	nonsense	probably null
R9683:Celsr3	UTSW	9	108827323	missense	probably damaging	1.00
R9794:Celsr3	UTSW	9	108851303	missense	probably benign	0.00
R9798:Celsr3	UTSW	9	108828595	missense	probably damaging	1.00
RF020:Celsr3	UTSW	9	108849057	missense	probably benign
X0018:Celsr3	UTSW	9	108827778	missense	possibly damaging	0.65
X0018:Celsr3	UTSW	9	108840412	missense	probably benign	0.01
X0026:Celsr3	UTSW	9	108828930	missense	probably damaging	0.99
Z1177:Celsr3	UTSW	9	108826477	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- ACATCTGCTCCTCTGGTCAG -3'
(R):5'- TACGAGAACTCATCACTTTGGG -3'

Sequencing Primer
(F):5'- AGCCGGGCCACTGTACATG -3'
(R):5'- CGAGAACTCATCACTTTGGGATTCTG -3'

Posted On

2014-06-23