Incidental Mutation 'R1839:Or2t48'
ID 205618
Institutional Source Beutler Lab
Gene Symbol Or2t48
Ensembl Gene ENSMUSG00000050818
Gene Name olfactory receptor family 2 subfamily T member 48
Synonyms Olfr330, MOR275-1, GA_x6K02T2NKPP-895420-896349
MMRRC Submission 045015-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R1839 (G1)
Quality Score 195
Status Not validated
Chromosome 11
Chromosomal Location 58419755-58425651 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 58420199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 204 (Y204*)
Ref Sequence ENSEMBL: ENSMUSP00000149073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134055] [ENSMUST00000213188]
AlphaFold Q8VGD9
Predicted Effect probably null
Transcript: ENSMUST00000062869
AA Change: Y204*
SMART Domains Protein: ENSMUSP00000063194
Gene: ENSMUSG00000050818
AA Change: Y204*

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 309 4.4e-6 PFAM
Pfam:7tm_1 45 294 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117184
Predicted Effect probably null
Transcript: ENSMUST00000134055
AA Change: Y204*
SMART Domains Protein: ENSMUSP00000145126
Gene: ENSMUSG00000050818
AA Change: Y204*

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 309 4.4e-6 PFAM
Pfam:7tm_1 45 294 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203550
SMART Domains Protein: ENSMUSP00000145138
Gene: ENSMUSG00000050818

DomainStartEndE-ValueType
Pfam:7tm_4 35 130 1.1e-13 PFAM
Pfam:7TM_GPCR_Srsx 39 130 1.3e-4 PFAM
Pfam:7tm_1 45 130 6.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213188
AA Change: Y204*
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,369 (GRCm39) T403A probably damaging Het
Acat3 T A 17: 13,147,493 (GRCm39) R175* probably null Het
Adam1b C A 5: 121,639,104 (GRCm39) C647F probably damaging Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adcy2 C T 13: 68,837,380 (GRCm39) probably null Het
Adcy5 A T 16: 35,069,310 (GRCm39) N426I probably damaging Het
Adgre1 T C 17: 57,748,299 (GRCm39) S500P probably benign Het
Aloxe3 A G 11: 69,020,911 (GRCm39) Y212C probably damaging Het
Ap3d1 A G 10: 80,562,942 (GRCm39) S180P probably damaging Het
Arhgap20 C T 9: 51,760,626 (GRCm39) R790W probably damaging Het
Atp8b4 C A 2: 126,203,702 (GRCm39) A757S possibly damaging Het
Begain G A 12: 109,001,249 (GRCm39) probably benign Het
Ccdc141 T C 2: 76,842,009 (GRCm39) E1474G probably benign Het
Ccdc88b A G 19: 6,831,477 (GRCm39) probably benign Het
Ccnk A G 12: 108,161,333 (GRCm39) T195A probably damaging Het
Cd55b C A 1: 130,341,842 (GRCm39) C265F probably damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Cenpt T C 8: 106,575,646 (GRCm39) S190G possibly damaging Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Cxxc4 C A 3: 133,946,414 (GRCm39) H332N probably damaging Het
Cyp24a1 T C 2: 170,338,661 (GRCm39) I12V probably benign Het
Cyp3a57 T A 5: 145,318,111 (GRCm39) L364Q probably damaging Het
Ddi2 T C 4: 141,440,837 (GRCm39) I47V probably benign Het
Ddx5 A T 11: 106,675,723 (GRCm39) D322E probably benign Het
Dhx40 A G 11: 86,680,123 (GRCm39) C405R possibly damaging Het
Emc1 T C 4: 139,087,796 (GRCm39) F100S probably damaging Het
Exoc2 T C 13: 31,090,480 (GRCm39) probably benign Het
Gm10110 A T 14: 90,135,272 (GRCm39) noncoding transcript Het
Gm17332 T C 11: 31,132,386 (GRCm39) H26R possibly damaging Het
Gna12 T C 5: 140,748,367 (GRCm39) N183S probably benign Het
Gpx6 A G 13: 21,496,497 (GRCm39) N24D probably benign Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Hsd3b5 T C 3: 98,527,044 (GRCm39) Y134C probably benign Het
Ifi213 T C 1: 173,417,166 (GRCm39) I415M probably damaging Het
Ints9 C A 14: 65,253,979 (GRCm39) P278T probably damaging Het
Krt79 C T 15: 101,846,373 (GRCm39) E192K possibly damaging Het
Lrrk2 A G 15: 91,567,337 (GRCm39) N132S probably benign Het
Ltn1 T A 16: 87,213,152 (GRCm39) K470* probably null Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Mcm9 A G 10: 53,417,649 (GRCm39) M18T probably damaging Het
Med12l A G 3: 58,975,740 (GRCm39) T212A probably benign Het
Mfhas1 T C 8: 36,058,012 (GRCm39) L829P possibly damaging Het
Mgme1 T A 2: 144,121,407 (GRCm39) C288S probably benign Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Nme4 A T 17: 26,311,071 (GRCm39) W165R probably damaging Het
Nup205 T A 6: 35,196,649 (GRCm39) D1128E probably benign Het
Or5ae2 T C 7: 84,505,756 (GRCm39) Y60H probably damaging Het
Pcdh1 T C 18: 38,332,538 (GRCm39) D155G possibly damaging Het
Pex12 A T 11: 83,188,648 (GRCm39) S116T probably damaging Het
Plekhh1 C T 12: 79,125,731 (GRCm39) probably benign Het
Plekhh3 A G 11: 101,054,426 (GRCm39) probably benign Het
Pnpt1 T C 11: 29,104,342 (GRCm39) M572T possibly damaging Het
Ppp1r12b T C 1: 134,765,719 (GRCm39) R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rgs14 T C 13: 55,530,651 (GRCm39) probably benign Het
Rhbdf2 A T 11: 116,491,017 (GRCm39) V645E possibly damaging Het
Robo3 A G 9: 37,333,623 (GRCm39) V696A probably benign Het
Sall1 A G 8: 89,755,344 (GRCm39) F1212L possibly damaging Het
Sdc4 T C 2: 164,270,932 (GRCm39) E109G probably benign Het
Serpind1 G T 16: 17,160,856 (GRCm39) R462L probably damaging Het
Smad9 CTTT CTT 3: 54,696,600 (GRCm39) probably benign Het
Sstr4 C A 2: 148,237,453 (GRCm39) N21K probably benign Het
Tap1 C T 17: 34,407,083 (GRCm39) A77V possibly damaging Het
Thap4 T C 1: 93,678,009 (GRCm39) E259G probably benign Het
Thra A G 11: 98,646,969 (GRCm39) N30S probably benign Het
Tmem207 A T 16: 26,343,571 (GRCm39) V27E possibly damaging Het
Top3a A G 11: 60,644,714 (GRCm39) V305A probably damaging Het
Trim59 A T 3: 68,944,971 (GRCm39) I123K probably damaging Het
Ttn T C 2: 76,691,839 (GRCm39) probably benign Het
Ubac1 T A 2: 25,897,750 (GRCm39) E290V possibly damaging Het
Unc13b T C 4: 43,258,308 (GRCm39) probably benign Het
Uri1 A T 7: 37,666,814 (GRCm39) D206E probably benign Het
Utp4 A G 8: 107,640,086 (GRCm39) H465R probably benign Het
Uvssa T C 5: 33,547,096 (GRCm39) S221P probably benign Het
Vmn1r39 T C 6: 66,782,217 (GRCm39) probably null Het
Vps39 A T 2: 120,155,878 (GRCm39) L514H probably damaging Het
Vps72 G A 3: 95,026,529 (GRCm39) R158Q possibly damaging Het
Wdr59 T C 8: 112,211,972 (GRCm39) D366G probably benign Het
Zfp366 C A 13: 99,365,000 (GRCm39) Q54K probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Or2t48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Or2t48 APN 11 58,420,222 (GRCm39) missense probably benign 0.17
IGL01672:Or2t48 APN 11 58,419,948 (GRCm39) missense probably benign 0.43
IGL01782:Or2t48 APN 11 58,419,985 (GRCm39) missense probably benign 0.03
IGL01998:Or2t48 APN 11 58,420,403 (GRCm39) nonsense probably null
IGL02538:Or2t48 APN 11 58,420,816 (GRCm39) utr 5 prime probably benign
R1670:Or2t48 UTSW 11 58,420,237 (GRCm39) missense probably damaging 1.00
R1727:Or2t48 UTSW 11 58,420,342 (GRCm39) missense possibly damaging 0.51
R1768:Or2t48 UTSW 11 58,420,602 (GRCm39) missense probably damaging 1.00
R2129:Or2t48 UTSW 11 58,420,437 (GRCm39) missense probably damaging 1.00
R2135:Or2t48 UTSW 11 58,420,611 (GRCm39) missense probably damaging 1.00
R2425:Or2t48 UTSW 11 58,420,137 (GRCm39) missense probably damaging 1.00
R3753:Or2t48 UTSW 11 58,420,516 (GRCm39) missense probably benign 0.00
R4480:Or2t48 UTSW 11 58,420,627 (GRCm39) missense probably damaging 0.99
R4827:Or2t48 UTSW 11 58,420,422 (GRCm39) missense probably damaging 0.99
R4836:Or2t48 UTSW 11 58,420,308 (GRCm39) missense probably damaging 0.99
R4973:Or2t48 UTSW 11 58,419,903 (GRCm39) missense probably benign
R5128:Or2t48 UTSW 11 58,420,248 (GRCm39) missense probably damaging 0.98
R5288:Or2t48 UTSW 11 58,420,308 (GRCm39) missense probably damaging 0.99
R5326:Or2t48 UTSW 11 58,420,710 (GRCm39) missense probably benign 0.02
R5542:Or2t48 UTSW 11 58,420,710 (GRCm39) missense probably benign 0.02
R5620:Or2t48 UTSW 11 58,420,557 (GRCm39) missense probably damaging 0.99
R6210:Or2t48 UTSW 11 58,420,090 (GRCm39) missense probably damaging 1.00
R7163:Or2t48 UTSW 11 58,419,994 (GRCm39) nonsense probably null
R7886:Or2t48 UTSW 11 58,419,880 (GRCm39) missense probably benign 0.01
R8201:Or2t48 UTSW 11 58,419,865 (GRCm39) makesense noncoding transcript
R8519:Or2t48 UTSW 11 58,420,329 (GRCm39) missense possibly damaging 0.94
R8728:Or2t48 UTSW 11 58,420,027 (GRCm39) missense probably benign 0.34
R9175:Or2t48 UTSW 11 58,420,590 (GRCm39) missense probably damaging 1.00
R9178:Or2t48 UTSW 11 58,420,473 (GRCm39) missense probably damaging 1.00
R9190:Or2t48 UTSW 11 58,420,161 (GRCm39) missense possibly damaging 0.89
R9471:Or2t48 UTSW 11 58,420,355 (GRCm39) nonsense probably null
RF003:Or2t48 UTSW 11 58,419,983 (GRCm39) frame shift probably null
RF004:Or2t48 UTSW 11 58,419,983 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCACCATGTCCTTCTCAGG -3'
(R):5'- GAACTACAGGGTTTGTCTCCTCC -3'

Sequencing Primer
(F):5'- CCATGTCCTTCTCAGGGGTGTG -3'
(R):5'- ACAGGGTTTGTCTCCTCCTGATG -3'
Posted On 2014-06-23