Incidental Mutation 'R1839:Olfr330'
ID205618
Institutional Source Beutler Lab
Gene Symbol Olfr330
Ensembl Gene ENSMUSG00000050818
Gene Nameolfactory receptor 330
SynonymsMOR275-1, GA_x6K02T2NKPP-895420-896349
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1839 (G1)
Quality Score195
Status Not validated
Chromosome11
Chromosomal Location58527186-58534836 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58529373 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 204 (Y204*)
Ref Sequence ENSEMBL: ENSMUSP00000149073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134055] [ENSMUST00000213188]
Predicted Effect probably null
Transcript: ENSMUST00000062869
AA Change: Y204*
SMART Domains Protein: ENSMUSP00000063194
Gene: ENSMUSG00000050818
AA Change: Y204*

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 309 4.4e-6 PFAM
Pfam:7tm_1 45 294 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117184
Predicted Effect probably null
Transcript: ENSMUST00000134055
AA Change: Y204*
SMART Domains Protein: ENSMUSP00000145126
Gene: ENSMUSG00000050818
AA Change: Y204*

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 309 4.4e-6 PFAM
Pfam:7tm_1 45 294 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203550
SMART Domains Protein: ENSMUSP00000145138
Gene: ENSMUSG00000050818

DomainStartEndE-ValueType
Pfam:7tm_4 35 130 1.1e-13 PFAM
Pfam:7TM_GPCR_Srsx 39 130 1.3e-4 PFAM
Pfam:7tm_1 45 130 6.3e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213188
AA Change: Y204*
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Olfr330
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Olfr330 APN 11 58529396 missense probably benign 0.17
IGL01672:Olfr330 APN 11 58529122 missense probably benign 0.43
IGL01782:Olfr330 APN 11 58529159 missense probably benign 0.03
IGL01998:Olfr330 APN 11 58529577 nonsense probably null
IGL02538:Olfr330 APN 11 58529990 utr 5 prime probably benign
R1670:Olfr330 UTSW 11 58529411 missense probably damaging 1.00
R1727:Olfr330 UTSW 11 58529516 missense possibly damaging 0.51
R1768:Olfr330 UTSW 11 58529776 missense probably damaging 1.00
R2129:Olfr330 UTSW 11 58529611 missense probably damaging 1.00
R2135:Olfr330 UTSW 11 58529785 missense probably damaging 1.00
R2425:Olfr330 UTSW 11 58529311 missense probably damaging 1.00
R3753:Olfr330 UTSW 11 58529690 missense probably benign 0.00
R4480:Olfr330 UTSW 11 58529801 missense probably damaging 0.99
R4827:Olfr330 UTSW 11 58529596 missense probably damaging 0.99
R4836:Olfr330 UTSW 11 58529482 missense probably damaging 0.99
R4973:Olfr330 UTSW 11 58529077 missense probably benign
R5128:Olfr330 UTSW 11 58529422 missense probably damaging 0.98
R5288:Olfr330 UTSW 11 58529482 missense probably damaging 0.99
R5326:Olfr330 UTSW 11 58529884 missense probably benign 0.02
R5542:Olfr330 UTSW 11 58529884 missense probably benign 0.02
R5620:Olfr330 UTSW 11 58529731 missense probably damaging 0.99
R6210:Olfr330 UTSW 11 58529264 missense probably damaging 1.00
R7163:Olfr330 UTSW 11 58529168 nonsense probably null
R7886:Olfr330 UTSW 11 58529054 missense probably benign 0.01
R7969:Olfr330 UTSW 11 58529054 missense probably benign 0.01
RF003:Olfr330 UTSW 11 58529157 frame shift probably null
RF004:Olfr330 UTSW 11 58529157 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCACCATGTCCTTCTCAGG -3'
(R):5'- GAACTACAGGGTTTGTCTCCTCC -3'

Sequencing Primer
(F):5'- CCATGTCCTTCTCAGGGGTGTG -3'
(R):5'- ACAGGGTTTGTCTCCTCCTGATG -3'
Posted On2014-06-23