Mutagenetix > Incidental Mutations

Incidental Mutation 'R1839:Aloxe3'

205620

Institutional Source

Beutler Lab

Gene Symbol

Aloxe3

Ensembl Gene

ENSMUSG00000020892

Gene Name

arachidonate lipoxygenase 3

Synonyms

e-LOX-3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1839 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69125896-69149115 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69130085 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 212 (Y212C)

Ref Sequence

ENSEMBL: ENSMUSP00000134814 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021268] [ENSMUST00000175661]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021268
AA Change: Y212C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021268
Gene: ENSMUSG00000020892
AA Change: Y212C

Domain	Start	End	E-Value	Type
LH2	2	116	1.93e-20	SMART
Pfam:Lipoxygenase	249	697	3.4e-76	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155324

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156874

Predicted Effect

probably damaging
Transcript: ENSMUST00000175661
AA Change: Y212C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134814
Gene: ENSMUSG00000020892
AA Change: Y212C

Domain	Start	End	E-Value	Type
LH2	2	116	1.93e-20	SMART
Pfam:Lipoxygenase	245	377	7.6e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176087

Meta Mutation Damage Score

0.7319

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.7%
20x: 90.6%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoxygenase family, which are catabolized by arachidonic acid-derived compounds. The encoded enzyme is a hydroperoxide isomerase that synthesizes a unique type of epoxy alcohol (8R-hydroxy-11R,12R-epoxyeicosa-5Z,9E,14Z-trienoic acid) from 12R-hydroperoxyeicosatetraenoic acid (12R-HPETE). This epoxy alcohol can activate the the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha), which is implicated in epidermal differentiation. Loss of function of the enzyme encoded by this gene results in ichthyosis, implicating the function of this gene in the differentiation of human skin. This gene is part of a cluster of lipoxygenase genes on 17p13.1. Mutations in this gene result in nonbullous congenital ichthyosiform erythroderma (NCIE). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality, imapired skin barrier function, dehydration, tightly packed stratum corneum, impaired stratum corneum desquamation and reduced levels of ester-bound ceramide in the epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	C	3: 124,409,720	T403A	probably damaging	Het
Acat3	T	A	17: 12,928,606	R175*	probably null	Het
Adam1b	C	A	5: 121,501,041	C647F	probably damaging	Het
Adam28	T	C	14: 68,639,210	N197S	possibly damaging	Het
Adcy2	C	T	13: 68,689,261		probably null	Het
Adcy5	A	T	16: 35,248,940	N426I	probably damaging	Het
Adgre1	T	C	17: 57,441,299	S500P	probably benign	Het
Ap3d1	A	G	10: 80,727,108	S180P	probably damaging	Het
Arhgap20	C	T	9: 51,849,326	R790W	probably damaging	Het
Atp8b4	C	A	2: 126,361,782	A757S	possibly damaging	Het
Begain	G	A	12: 109,035,323		probably benign	Het
Ccdc141	T	C	2: 77,011,665	E1474G	probably benign	Het
Ccdc88b	A	G	19: 6,854,109		probably benign	Het
Ccnk	A	G	12: 108,195,074	T195A	probably damaging	Het
Cd55b	C	A	1: 130,414,105	C265F	probably damaging	Het
Celsr3	A	G	9: 108,829,906	H1196R	probably benign	Het
Cenpt	T	C	8: 105,849,014	S190G	possibly damaging	Het
Chd8	T	C	14: 52,204,883	S2077G	probably benign	Het
Col6a5	G	A	9: 105,864,833	H2296Y	probably benign	Het
Cxxc4	C	A	3: 134,240,653	H332N	probably damaging	Het
Cyp24a1	T	C	2: 170,496,741	I12V	probably benign	Het
Cyp3a57	T	A	5: 145,381,301	L364Q	probably damaging	Het
Ddi2	T	C	4: 141,713,526	I47V	probably benign	Het
Ddx5	A	T	11: 106,784,897	D322E	probably benign	Het
Dhx40	A	G	11: 86,789,297	C405R	possibly damaging	Het
Emc1	T	C	4: 139,360,485	F100S	probably damaging	Het
Exoc2	T	C	13: 30,906,497		probably benign	Het
Gm10110	A	T	14: 89,897,836		noncoding transcript	Het
Gm17332	T	C	11: 31,182,386	H26R	possibly damaging	Het
Gna12	T	C	5: 140,762,612	N183S	probably benign	Het
Gpx6	A	G	13: 21,312,327	N24D	probably benign	Het
Gsdma3	C	T	11: 98,629,858	A105V	probably benign	Het
Hsd3b5	T	C	3: 98,619,728	Y134C	probably benign	Het
Ifi213	T	C	1: 173,589,600	I415M	probably damaging	Het
Ints9	C	A	14: 65,016,530	P278T	probably damaging	Het
Krt79	C	T	15: 101,937,938	E192K	possibly damaging	Het
Lrrk2	A	G	15: 91,683,134	N132S	probably benign	Het
Ltn1	T	A	16: 87,416,264	K470*	probably null	Het
Magi2	A	T	5: 20,465,827	T163S	probably damaging	Het
Mcm9	A	G	10: 53,541,553	M18T	probably damaging	Het
Med12l	A	G	3: 59,068,319	T212A	probably benign	Het
Mfhas1	T	C	8: 35,590,858	L829P	possibly damaging	Het
Mgme1	T	A	2: 144,279,487	C288S	probably benign	Het
Muc4	G	C	16: 32,753,919	R1265P	probably benign	Het
Myh7	T	C	14: 54,973,180	N1725S	possibly damaging	Het
Nat6	G	A	9: 107,583,017	R37H	possibly damaging	Het
Nme4	A	T	17: 26,092,097	W165R	probably damaging	Het
Nup205	T	A	6: 35,219,714	D1128E	probably benign	Het
Olfr291	T	C	7: 84,856,548	Y60H	probably damaging	Het
Olfr330	A	T	11: 58,529,373	Y204*	probably null	Het
Pcdh1	T	C	18: 38,199,485	D155G	possibly damaging	Het
Pex12	A	T	11: 83,297,822	S116T	probably damaging	Het
Plekhh1	C	T	12: 79,078,957		probably benign	Het
Plekhh3	A	G	11: 101,163,600		probably benign	Het
Pnpt1	T	C	11: 29,154,342	M572T	possibly damaging	Het
Ppp1r12b	T	C	1: 134,837,981	R667G	probably benign	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Rgs14	T	C	13: 55,382,838		probably benign	Het
Rhbdf2	A	T	11: 116,600,191	V645E	possibly damaging	Het
Robo3	A	G	9: 37,422,327	V696A	probably benign	Het
Sall1	A	G	8: 89,028,716	F1212L	possibly damaging	Het
Sdc4	T	C	2: 164,429,012	E109G	probably benign	Het
Serpind1	G	T	16: 17,342,992	R462L	probably damaging	Het
Smad9	CTTT	CTT	3: 54,789,179		probably benign	Het
Sstr4	C	A	2: 148,395,533	N21K	probably benign	Het
Tap1	C	T	17: 34,188,109	A77V	possibly damaging	Het
Thap4	T	C	1: 93,750,287	E259G	probably benign	Het
Thra	A	G	11: 98,756,143	N30S	probably benign	Het
Tmem207	A	T	16: 26,524,821	V27E	possibly damaging	Het
Top3a	A	G	11: 60,753,888	V305A	probably damaging	Het
Trim59	A	T	3: 69,037,638	I123K	probably damaging	Het
Ttn	T	C	2: 76,861,495		probably benign	Het
Ubac1	T	A	2: 26,007,738	E290V	possibly damaging	Het
Unc13b	T	C	4: 43,258,308		probably benign	Het
Uri1	A	T	7: 37,967,389	D206E	probably benign	Het
Utp4	A	G	8: 106,913,454	H465R	probably benign	Het
Uvssa	T	C	5: 33,389,752	S221P	probably benign	Het
Vmn1r39	T	C	6: 66,805,233		probably null	Het
Vps39	A	T	2: 120,325,397	L514H	probably damaging	Het
Vps72	G	A	3: 95,119,218	R158Q	possibly damaging	Het
Wdr59	T	C	8: 111,485,340	D366G	probably benign	Het
Zfp366	C	A	13: 99,228,492	Q54K	probably damaging	Het
Zfp523	T	A	17: 28,194,993	I34N	probably damaging	Het
Zfp974	G	A	7: 27,910,356	P648L	possibly damaging	Het

Other mutations in Aloxe3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01621:Aloxe3	APN	11	69130013	missense	probably benign	0.41
IGL01925:Aloxe3	APN	11	69128633	missense	probably damaging	1.00
IGL01947:Aloxe3	APN	11	69143021	splice site	probably benign
IGL02421:Aloxe3	APN	11	69130046	missense	possibly damaging	0.87
IGL03206:Aloxe3	APN	11	69129646	missense	possibly damaging	0.74
IGL03054:Aloxe3	UTSW	11	69129607	missense	possibly damaging	0.78
R1613:Aloxe3	UTSW	11	69130046	missense	possibly damaging	0.87
R1757:Aloxe3	UTSW	11	69135949	missense	possibly damaging	0.72
R2182:Aloxe3	UTSW	11	69129600	missense	possibly damaging	0.93
R2912:Aloxe3	UTSW	11	69130040	missense	probably damaging	1.00
R2919:Aloxe3	UTSW	11	69142923	missense	probably damaging	0.99
R2920:Aloxe3	UTSW	11	69142923	missense	probably damaging	0.99
R4731:Aloxe3	UTSW	11	69128654	missense	probably null	0.59
R5245:Aloxe3	UTSW	11	69129676	missense	probably benign	0.00
R5459:Aloxe3	UTSW	11	69132828	missense	possibly damaging	0.66
R5493:Aloxe3	UTSW	11	69128617	nonsense	probably null
R5725:Aloxe3	UTSW	11	69128654	missense	probably null	0.59
R5755:Aloxe3	UTSW	11	69132749	missense	probably benign	0.04
R5789:Aloxe3	UTSW	11	69126439	missense	probably damaging	1.00
R7343:Aloxe3	UTSW	11	69132743	missense	probably benign	0.00
R7419:Aloxe3	UTSW	11	69127527	missense	probably benign	0.00
R7451:Aloxe3	UTSW	11	69142920	missense	possibly damaging	0.90
R7669:Aloxe3	UTSW	11	69135120	missense	probably benign	0.00
X0019:Aloxe3	UTSW	11	69148735	missense	probably damaging	1.00
X0020:Aloxe3	UTSW	11	69133027	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCTCACGTGGTTAGCAGAGG -3'
(R):5'- GGGACCACACCCTGAATAGG -3'

Sequencing Primer
(F):5'- AAGAAAGAGGTTCCTTCTGCTTTG -3'
(R):5'- CCTGAATAGGGAGGAGATGAAGGAC -3'

Posted On

2014-06-23