Incidental Mutation 'R1839:Gsdma3'
ID205623
Institutional Source Beutler Lab
Gene Symbol Gsdma3
Ensembl Gene ENSMUSG00000064224
Gene Namegasdermin A3
SynonymsGsdm1l, Bsk, Rim3, Dfl, Rco2, Gsdm3, Fgn
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1839 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98626360-98638226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98629858 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 105 (A105V)
Ref Sequence ENSEMBL: ENSMUSP00000103132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073295] [ENSMUST00000104933] [ENSMUST00000107508]
Predicted Effect probably benign
Transcript: ENSMUST00000073295
AA Change: A105V

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073022
Gene: ENSMUSG00000064224
AA Change: A105V

DomainStartEndE-ValueType
Pfam:Gasdermin 3 430 1.4e-132 PFAM
low complexity region 438 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000104933
SMART Domains Protein: ENSMUSP00000100538
Gene: ENSMUSG00000078134

DomainStartEndE-ValueType
RRM 10 78 7.02e-19 SMART
low complexity region 97 142 N/A INTRINSIC
low complexity region 147 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107508
AA Change: A105V

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103132
Gene: ENSMUSG00000064224
AA Change: A105V

DomainStartEndE-ValueType
Pfam:Gasdermin 3 421 9.5e-134 PFAM
low complexity region 429 443 N/A INTRINSIC
Meta Mutation Damage Score 0.3111 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype PHENOTYPE: Mutations of this gene affect normal development of the hair follicle, resulting in abnormal coats. Some alleles are associated with corneal opacity and/or microphthalmia. For one allele, high rates of mutation are observed in the MHC that appear to be associated with intra-MHC recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Gsdma3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Gsdma3 APN 11 98637572 missense probably damaging 0.97
IGL01375:Gsdma3 APN 11 98629941 critical splice donor site probably null
IGL01721:Gsdma3 APN 11 98637956 missense possibly damaging 0.95
IGL02179:Gsdma3 APN 11 98635271 missense possibly damaging 0.88
IGL02612:Gsdma3 APN 11 98635881 missense probably damaging 0.99
IGL02866:Gsdma3 APN 11 98629759 missense possibly damaging 0.88
IGL02970:Gsdma3 APN 11 98632993 missense probably benign 0.01
Michelin UTSW 11 98637573 missense probably damaging 0.98
Mr_magoo UTSW 11 98635919 missense probably damaging 1.00
PIT4486001:Gsdma3 UTSW 11 98638054 missense unknown
R0408:Gsdma3 UTSW 11 98635338 missense probably benign 0.41
R0539:Gsdma3 UTSW 11 98635919 missense probably damaging 1.00
R0675:Gsdma3 UTSW 11 98631191 missense probably benign 0.03
R1329:Gsdma3 UTSW 11 98632392 missense probably damaging 1.00
R1759:Gsdma3 UTSW 11 98635245 missense possibly damaging 0.93
R1812:Gsdma3 UTSW 11 98632393 missense probably damaging 0.99
R1838:Gsdma3 UTSW 11 98629858 missense probably benign 0.19
R2287:Gsdma3 UTSW 11 98638004 missense possibly damaging 0.83
R4883:Gsdma3 UTSW 11 98629567 critical splice donor site probably null
R6767:Gsdma3 UTSW 11 98637884 missense possibly damaging 0.93
R7053:Gsdma3 UTSW 11 98629795 missense possibly damaging 0.75
R7733:Gsdma3 UTSW 11 98635215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAAGCCCAGAGTTCTCT -3'
(R):5'- TCTTATCTTGGCTTCCAATTGCA -3'

Sequencing Primer
(F):5'- CTCTCTGGGGGTGCTGATGAG -3'
(R):5'- CTTAGCCATCCTGATAGGTACAG -3'
Posted On2014-06-23