Incidental Mutation 'R0113:Fcrla'
ID 20563
Institutional Source Beutler Lab
Gene Symbol Fcrla
Ensembl Gene ENSMUSG00000038421
Gene Name Fc receptor-like A
Synonyms FREB, Fcrx, Freb1, mFcrX, mFREB, FCRL1
MMRRC Submission 038399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0113 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 1
Chromosomal Location 170917576-170927583 bp(-) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 170922299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000124469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046322] [ENSMUST00000159149] [ENSMUST00000159171] [ENSMUST00000162136] [ENSMUST00000162887]
AlphaFold Q920A9
Predicted Effect probably benign
Transcript: ENSMUST00000046322
AA Change: M63K

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000036380
Gene: ENSMUSG00000038421
AA Change: M63K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
IG 95 177 5.75e-4 SMART
IG 188 272 1.4e-7 SMART
low complexity region 281 296 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159149
AA Change: M34K

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125074
Gene: ENSMUSG00000038421
AA Change: M34K

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
IG 66 148 5.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159171
AA Change: M62K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124853
Gene: ENSMUSG00000038421
AA Change: M62K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
IG 94 176 5.75e-4 SMART
IG 187 271 1.4e-7 SMART
low complexity region 280 295 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161050
Predicted Effect probably benign
Transcript: ENSMUST00000162136
AA Change: M63K

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124859
Gene: ENSMUSG00000038421
AA Change: M63K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:Ig_2 83 150 2.2e-6 PFAM
Pfam:Ig_2 156 215 1e-3 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162887
AA Change: M1K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124469
Gene: ENSMUSG00000038421
AA Change: M1K

DomainStartEndE-ValueType
Pfam:Ig_2 28 78 1.4e-7 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 95.2%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to receptors for the Fc fragment of gamma immunoglobulin (IgG). These receptors, referred to as FCGRs, mediate the destruction of IgG-coated antigens and of cells induced by antibodies. This encoded protein is selectively expressed in B cells, and may be involved in their development. This protein may also be involved in the development of lymphomas. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit largely normal T-dependent and T-independent antibody responses with an increase in IgG1 after secondary challenge with sheep red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik A G 8: 10,926,126 noncoding transcript Het
4930432K21Rik C T 8: 84,167,242 T311I probably damaging Het
Abca13 A T 11: 9,292,114 I1326F possibly damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Aspscr1 C G 11: 120,688,925 Q97E probably damaging Het
Atad2 A G 15: 58,120,934 probably benign Het
Atcay A T 10: 81,214,720 probably null Het
C4b T A 17: 34,741,240 Y279F probably damaging Het
Cav1 A T 6: 17,308,049 S67C possibly damaging Het
Celf2 A C 2: 6,624,714 H113Q probably damaging Het
Cep170 A C 1: 176,758,455 N590K probably damaging Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chrna1 C A 2: 73,566,836 D370Y possibly damaging Het
Csmd1 C A 8: 15,984,849 G2441C probably damaging Het
D630003M21Rik C T 2: 158,196,575 D984N possibly damaging Het
Dhrs1 T C 14: 55,739,939 T241A probably benign Het
Edar A C 10: 58,629,449 C31G probably damaging Het
Eps8 A G 6: 137,537,684 S24P possibly damaging Het
Fam149a T C 8: 45,341,024 E669G probably damaging Het
G3bp1 T A 11: 55,495,426 V237E probably benign Het
Galnt5 A G 2: 57,998,877 E163G probably benign Het
Gm5155 G A 7: 17,908,948 noncoding transcript Het
Gpr87 T C 3: 59,179,511 D192G possibly damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Ints1 T C 5: 139,765,213 T810A Het
Kalrn A G 16: 34,049,936 probably benign Het
Kcnk6 T C 7: 29,232,209 D92G probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mfsd6 A T 1: 52,709,189 N172K probably damaging Het
Mtcl1 G T 17: 66,354,242 Q1225K possibly damaging Het
Nav2 C T 7: 49,535,953 T948M probably damaging Het
Nfic T C 10: 81,420,585 K104E probably damaging Het
Nupl1 G A 14: 60,251,291 probably benign Het
Nwd2 A T 5: 63,807,898 K1608N probably damaging Het
Olfr148 T A 9: 39,614,002 I145K probably benign Het
Olfr50 G A 2: 36,793,994 G253R probably damaging Het
Olfr50 G T 2: 36,793,995 G253V probably damaging Het
Phf21b T C 15: 84,804,767 D186G probably damaging Het
Poli C T 18: 70,528,758 C57Y probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Psg23 T C 7: 18,612,002 Y256C probably benign Het
Satb1 C A 17: 51,782,698 E374* probably null Het
Scn4a C T 11: 106,345,436 E333K probably benign Het
Sec14l2 C T 11: 4,103,661 probably benign Het
Slain1 T C 14: 103,685,825 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syne2 T C 12: 75,930,578 S1266P probably damaging Het
Syne2 A G 12: 76,033,722 E4810G probably damaging Het
Tbck T C 3: 132,743,080 I618T probably damaging Het
Tmem132d A T 5: 127,784,593 N821K probably benign Het
Trim28 T A 7: 13,028,701 V381E probably damaging Het
Ttc1 T C 11: 43,745,288 S43G probably benign Het
Ube2u A G 4: 100,481,655 E39G possibly damaging Het
Urb2 T C 8: 124,030,926 V1124A probably benign Het
Usp13 A G 3: 32,817,876 probably benign Het
Vmn1r216 A T 13: 23,099,461 S105C probably damaging Het
Yipf2 T C 9: 21,590,116 T23A probably damaging Het
Zfp521 G A 18: 13,845,091 T755M probably damaging Het
Zfp619 T A 7: 39,537,759 M1071K probably benign Het
Zfp942 A T 17: 21,929,085 C188S probably benign Het
Other mutations in Fcrla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Fcrla APN 1 170927498 missense probably benign 0.00
IGL01712:Fcrla APN 1 170921623 splice site probably null
IGL03323:Fcrla APN 1 170927545 utr 5 prime probably benign
R1457:Fcrla UTSW 1 170921004 missense probably damaging 1.00
R1917:Fcrla UTSW 1 170927526 nonsense probably null
R4331:Fcrla UTSW 1 170921676 missense possibly damaging 0.74
R4819:Fcrla UTSW 1 170920939 missense probably damaging 0.99
R4923:Fcrla UTSW 1 170921113 missense probably damaging 1.00
R5000:Fcrla UTSW 1 170922390 missense probably benign 0.03
R5441:Fcrla UTSW 1 170925422 intron probably benign
R5459:Fcrla UTSW 1 170918169 missense possibly damaging 0.68
R6575:Fcrla UTSW 1 170922228 missense probably damaging 1.00
R7369:Fcrla UTSW 1 170922317 missense probably benign 0.23
R7786:Fcrla UTSW 1 170920857 missense possibly damaging 0.93
R9276:Fcrla UTSW 1 170927566 unclassified probably benign
R9482:Fcrla UTSW 1 170918380 missense probably benign 0.00
R9585:Fcrla UTSW 1 170922299 start codon destroyed probably null 0.04
R9622:Fcrla UTSW 1 170922239 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGGGAACGTCTACCTATGCCAG -3'
(R):5'- AAGGTCAAAGCCATCCCAGTGAAG -3'

Sequencing Primer
(F):5'- CTATGCCAGTTCCCTGAGTGG -3'
(R):5'- TGAAGACCCATAGGAGCCTCTTAG -3'
Posted On 2013-04-11