Incidental Mutation 'R1839:Zfp366'
ID 205634
Institutional Source Beutler Lab
Gene Symbol Zfp366
Ensembl Gene ENSMUSG00000050919
Gene Name zinc finger protein 366
Synonyms DC-SCRIPT
MMRRC Submission 045015-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.331) question?
Stock # R1839 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 99321331-99383540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 99365000 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 54 (Q54K)
Ref Sequence ENSEMBL: ENSMUSP00000060040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056558]
AlphaFold Q6NS86
Predicted Effect probably damaging
Transcript: ENSMUST00000056558
AA Change: Q54K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060040
Gene: ENSMUSG00000050919
AA Change: Q54K

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
ZnF_C2H2 250 272 1.18e-2 SMART
ZnF_C2H2 278 300 4.05e-1 SMART
ZnF_C2H2 306 328 1.79e-2 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 362 384 1.89e-1 SMART
ZnF_C2H2 390 412 1.22e-4 SMART
ZnF_C2H2 418 440 1.36e-2 SMART
ZnF_C2H2 446 468 1.1e-2 SMART
ZnF_C2H2 474 496 8.34e-3 SMART
ZnF_C2H2 502 524 5.42e-2 SMART
ZnF_C2H2 530 553 2.4e-3 SMART
low complexity region 615 623 N/A INTRINSIC
Meta Mutation Damage Score 0.1497 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit perimembranous and muscular ventricular septal defects (VSD), and overriding aorta. Short snout, micrognathia, micropthalmia, hypoplastic thymus, and hydronephrosis are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,369 (GRCm39) T403A probably damaging Het
Acat3 T A 17: 13,147,493 (GRCm39) R175* probably null Het
Adam1b C A 5: 121,639,104 (GRCm39) C647F probably damaging Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adcy2 C T 13: 68,837,380 (GRCm39) probably null Het
Adcy5 A T 16: 35,069,310 (GRCm39) N426I probably damaging Het
Adgre1 T C 17: 57,748,299 (GRCm39) S500P probably benign Het
Aloxe3 A G 11: 69,020,911 (GRCm39) Y212C probably damaging Het
Ap3d1 A G 10: 80,562,942 (GRCm39) S180P probably damaging Het
Arhgap20 C T 9: 51,760,626 (GRCm39) R790W probably damaging Het
Atp8b4 C A 2: 126,203,702 (GRCm39) A757S possibly damaging Het
Begain G A 12: 109,001,249 (GRCm39) probably benign Het
Ccdc141 T C 2: 76,842,009 (GRCm39) E1474G probably benign Het
Ccdc88b A G 19: 6,831,477 (GRCm39) probably benign Het
Ccnk A G 12: 108,161,333 (GRCm39) T195A probably damaging Het
Cd55b C A 1: 130,341,842 (GRCm39) C265F probably damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Cenpt T C 8: 106,575,646 (GRCm39) S190G possibly damaging Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Cxxc4 C A 3: 133,946,414 (GRCm39) H332N probably damaging Het
Cyp24a1 T C 2: 170,338,661 (GRCm39) I12V probably benign Het
Cyp3a57 T A 5: 145,318,111 (GRCm39) L364Q probably damaging Het
Ddi2 T C 4: 141,440,837 (GRCm39) I47V probably benign Het
Ddx5 A T 11: 106,675,723 (GRCm39) D322E probably benign Het
Dhx40 A G 11: 86,680,123 (GRCm39) C405R possibly damaging Het
Emc1 T C 4: 139,087,796 (GRCm39) F100S probably damaging Het
Exoc2 T C 13: 31,090,480 (GRCm39) probably benign Het
Gm10110 A T 14: 90,135,272 (GRCm39) noncoding transcript Het
Gm17332 T C 11: 31,132,386 (GRCm39) H26R possibly damaging Het
Gna12 T C 5: 140,748,367 (GRCm39) N183S probably benign Het
Gpx6 A G 13: 21,496,497 (GRCm39) N24D probably benign Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Hsd3b5 T C 3: 98,527,044 (GRCm39) Y134C probably benign Het
Ifi213 T C 1: 173,417,166 (GRCm39) I415M probably damaging Het
Ints9 C A 14: 65,253,979 (GRCm39) P278T probably damaging Het
Krt79 C T 15: 101,846,373 (GRCm39) E192K possibly damaging Het
Lrrk2 A G 15: 91,567,337 (GRCm39) N132S probably benign Het
Ltn1 T A 16: 87,213,152 (GRCm39) K470* probably null Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Mcm9 A G 10: 53,417,649 (GRCm39) M18T probably damaging Het
Med12l A G 3: 58,975,740 (GRCm39) T212A probably benign Het
Mfhas1 T C 8: 36,058,012 (GRCm39) L829P possibly damaging Het
Mgme1 T A 2: 144,121,407 (GRCm39) C288S probably benign Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Nme4 A T 17: 26,311,071 (GRCm39) W165R probably damaging Het
Nup205 T A 6: 35,196,649 (GRCm39) D1128E probably benign Het
Or2t48 A T 11: 58,420,199 (GRCm39) Y204* probably null Het
Or5ae2 T C 7: 84,505,756 (GRCm39) Y60H probably damaging Het
Pcdh1 T C 18: 38,332,538 (GRCm39) D155G possibly damaging Het
Pex12 A T 11: 83,188,648 (GRCm39) S116T probably damaging Het
Plekhh1 C T 12: 79,125,731 (GRCm39) probably benign Het
Plekhh3 A G 11: 101,054,426 (GRCm39) probably benign Het
Pnpt1 T C 11: 29,104,342 (GRCm39) M572T possibly damaging Het
Ppp1r12b T C 1: 134,765,719 (GRCm39) R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rgs14 T C 13: 55,530,651 (GRCm39) probably benign Het
Rhbdf2 A T 11: 116,491,017 (GRCm39) V645E possibly damaging Het
Robo3 A G 9: 37,333,623 (GRCm39) V696A probably benign Het
Sall1 A G 8: 89,755,344 (GRCm39) F1212L possibly damaging Het
Sdc4 T C 2: 164,270,932 (GRCm39) E109G probably benign Het
Serpind1 G T 16: 17,160,856 (GRCm39) R462L probably damaging Het
Smad9 CTTT CTT 3: 54,696,600 (GRCm39) probably benign Het
Sstr4 C A 2: 148,237,453 (GRCm39) N21K probably benign Het
Tap1 C T 17: 34,407,083 (GRCm39) A77V possibly damaging Het
Thap4 T C 1: 93,678,009 (GRCm39) E259G probably benign Het
Thra A G 11: 98,646,969 (GRCm39) N30S probably benign Het
Tmem207 A T 16: 26,343,571 (GRCm39) V27E possibly damaging Het
Top3a A G 11: 60,644,714 (GRCm39) V305A probably damaging Het
Trim59 A T 3: 68,944,971 (GRCm39) I123K probably damaging Het
Ttn T C 2: 76,691,839 (GRCm39) probably benign Het
Ubac1 T A 2: 25,897,750 (GRCm39) E290V possibly damaging Het
Unc13b T C 4: 43,258,308 (GRCm39) probably benign Het
Uri1 A T 7: 37,666,814 (GRCm39) D206E probably benign Het
Utp4 A G 8: 107,640,086 (GRCm39) H465R probably benign Het
Uvssa T C 5: 33,547,096 (GRCm39) S221P probably benign Het
Vmn1r39 T C 6: 66,782,217 (GRCm39) probably null Het
Vps39 A T 2: 120,155,878 (GRCm39) L514H probably damaging Het
Vps72 G A 3: 95,026,529 (GRCm39) R158Q possibly damaging Het
Wdr59 T C 8: 112,211,972 (GRCm39) D366G probably benign Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Zfp366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Zfp366 APN 13 99,383,080 (GRCm39) utr 3 prime probably benign
IGL01626:Zfp366 APN 13 99,364,920 (GRCm39) missense probably damaging 0.99
IGL02227:Zfp366 APN 13 99,370,696 (GRCm39) missense possibly damaging 0.85
IGL03074:Zfp366 APN 13 99,382,913 (GRCm39) missense probably benign
R0126:Zfp366 UTSW 13 99,365,129 (GRCm39) missense probably benign 0.14
R0145:Zfp366 UTSW 13 99,366,048 (GRCm39) missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99,370,768 (GRCm39) missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99,370,768 (GRCm39) missense probably damaging 1.00
R0376:Zfp366 UTSW 13 99,370,759 (GRCm39) missense probably benign 0.00
R0537:Zfp366 UTSW 13 99,365,786 (GRCm39) missense probably damaging 1.00
R0637:Zfp366 UTSW 13 99,365,474 (GRCm39) missense probably damaging 0.99
R0838:Zfp366 UTSW 13 99,365,118 (GRCm39) missense possibly damaging 0.73
R1386:Zfp366 UTSW 13 99,383,063 (GRCm39) missense probably damaging 0.98
R1422:Zfp366 UTSW 13 99,365,804 (GRCm39) missense probably damaging 1.00
R1669:Zfp366 UTSW 13 99,366,069 (GRCm39) missense probably damaging 0.99
R3751:Zfp366 UTSW 13 99,365,352 (GRCm39) missense probably damaging 1.00
R4782:Zfp366 UTSW 13 99,382,991 (GRCm39) missense probably damaging 1.00
R4908:Zfp366 UTSW 13 99,370,609 (GRCm39) missense possibly damaging 0.68
R4992:Zfp366 UTSW 13 99,366,003 (GRCm39) missense possibly damaging 0.62
R5040:Zfp366 UTSW 13 99,364,875 (GRCm39) missense probably damaging 1.00
R5086:Zfp366 UTSW 13 99,365,451 (GRCm39) missense probably benign 0.00
R5186:Zfp366 UTSW 13 99,382,676 (GRCm39) missense probably benign 0.00
R5249:Zfp366 UTSW 13 99,366,117 (GRCm39) missense probably damaging 1.00
R5450:Zfp366 UTSW 13 99,366,093 (GRCm39) missense probably damaging 1.00
R6838:Zfp366 UTSW 13 99,382,685 (GRCm39) missense possibly damaging 0.83
R6838:Zfp366 UTSW 13 99,365,015 (GRCm39) missense possibly damaging 0.93
R7250:Zfp366 UTSW 13 99,366,076 (GRCm39) missense probably damaging 1.00
R7378:Zfp366 UTSW 13 99,366,023 (GRCm39) missense probably damaging 1.00
R7571:Zfp366 UTSW 13 99,382,895 (GRCm39) missense probably benign 0.03
R7624:Zfp366 UTSW 13 99,382,804 (GRCm39) missense probably benign
R7653:Zfp366 UTSW 13 99,365,709 (GRCm39) missense probably damaging 1.00
R8367:Zfp366 UTSW 13 99,380,551 (GRCm39) missense possibly damaging 0.95
R9510:Zfp366 UTSW 13 99,365,874 (GRCm39) missense probably damaging 1.00
R9658:Zfp366 UTSW 13 99,365,435 (GRCm39) missense probably benign 0.13
R9734:Zfp366 UTSW 13 99,365,352 (GRCm39) missense probably damaging 1.00
Z1176:Zfp366 UTSW 13 99,382,858 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTTTAAAGGGAAACTGCAGAG -3'
(R):5'- TCATCTGGGAGTCGCACTTG -3'

Sequencing Primer
(F):5'- CGAAAAGCATCCCCTCTT -3'
(R):5'- CTGTGGCTGCGGGAAAAGTAG -3'
Posted On 2014-06-23