Incidental Mutation 'R1839:Gm10110'
ID205639
Institutional Source Beutler Lab
Gene Symbol Gm10110
Ensembl Gene ENSMUSG00000062093
Gene Namepredicted gene 10110
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R1839 (G1)
Quality Score110
Status Validated
Chromosome14
Chromosomal Location89896223-89898466 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 89897836 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000081204]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081204
SMART Domains Protein: ENSMUSP00000079967
Gene: ENSMUSG00000062093

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 1.92e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228705
Meta Mutation Damage Score 0.8107 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Gm10110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Gm10110 APN 14 89898241 exon noncoding transcript
IGL02308:Gm10110 APN 14 89897595 exon noncoding transcript
IGL02977:Gm10110 APN 14 89897332 exon noncoding transcript
IGL03230:Gm10110 APN 14 89898297 exon noncoding transcript
R0966:Gm10110 UTSW 14 89898119 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1640:Gm10110 UTSW 14 89898243 exon noncoding transcript
R1762:Gm10110 UTSW 14 89897389 exon noncoding transcript
R2679:Gm10110 UTSW 14 89897416 exon noncoding transcript
R3907:Gm10110 UTSW 14 89898147 exon noncoding transcript
R4512:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4513:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4590:Gm10110 UTSW 14 89897546 exon noncoding transcript
R4877:Gm10110 UTSW 14 89897349 exon noncoding transcript
R5771:Gm10110 UTSW 14 89897239 exon noncoding transcript
R6333:Gm10110 UTSW 14 89898297 exon noncoding transcript
R6341:Gm10110 UTSW 14 89896708 exon noncoding transcript
R8235:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8236:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8237:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8281:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8282:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8283:Gm10110 UTSW 14 89898241 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- GTGCACGGCCTACAAATATGG -3'
(R):5'- ATGAGAACGGCTCTAAGGGC -3'

Sequencing Primer
(F):5'- GCACGGCCTACAAATATGGCTTTC -3'
(R):5'- TTGTTCACTTCGAGACCCAAGAGG -3'
Posted On2014-06-23