Incidental Mutation 'R1839:Gm10110'
ID 205639
Institutional Source Beutler Lab
Gene Symbol Gm10110
Ensembl Gene ENSMUSG00000062093
Gene Name predicted gene 10110
Synonyms
MMRRC Submission 045015-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.215) question?
Stock # R1839 (G1)
Quality Score 110
Status Validated
Chromosome 14
Chromosomal Location 90133664-90136883 bp(-) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) A to T at 90135272 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000081204]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081204
SMART Domains Protein: ENSMUSP00000079967
Gene: ENSMUSG00000062093

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 1.92e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228705
Meta Mutation Damage Score 0.8107 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,369 (GRCm39) T403A probably damaging Het
Acat3 T A 17: 13,147,493 (GRCm39) R175* probably null Het
Adam1b C A 5: 121,639,104 (GRCm39) C647F probably damaging Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adcy2 C T 13: 68,837,380 (GRCm39) probably null Het
Adcy5 A T 16: 35,069,310 (GRCm39) N426I probably damaging Het
Adgre1 T C 17: 57,748,299 (GRCm39) S500P probably benign Het
Aloxe3 A G 11: 69,020,911 (GRCm39) Y212C probably damaging Het
Ap3d1 A G 10: 80,562,942 (GRCm39) S180P probably damaging Het
Arhgap20 C T 9: 51,760,626 (GRCm39) R790W probably damaging Het
Atp8b4 C A 2: 126,203,702 (GRCm39) A757S possibly damaging Het
Begain G A 12: 109,001,249 (GRCm39) probably benign Het
Ccdc141 T C 2: 76,842,009 (GRCm39) E1474G probably benign Het
Ccdc88b A G 19: 6,831,477 (GRCm39) probably benign Het
Ccnk A G 12: 108,161,333 (GRCm39) T195A probably damaging Het
Cd55b C A 1: 130,341,842 (GRCm39) C265F probably damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Cenpt T C 8: 106,575,646 (GRCm39) S190G possibly damaging Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Cxxc4 C A 3: 133,946,414 (GRCm39) H332N probably damaging Het
Cyp24a1 T C 2: 170,338,661 (GRCm39) I12V probably benign Het
Cyp3a57 T A 5: 145,318,111 (GRCm39) L364Q probably damaging Het
Ddi2 T C 4: 141,440,837 (GRCm39) I47V probably benign Het
Ddx5 A T 11: 106,675,723 (GRCm39) D322E probably benign Het
Dhx40 A G 11: 86,680,123 (GRCm39) C405R possibly damaging Het
Emc1 T C 4: 139,087,796 (GRCm39) F100S probably damaging Het
Exoc2 T C 13: 31,090,480 (GRCm39) probably benign Het
Gm17332 T C 11: 31,132,386 (GRCm39) H26R possibly damaging Het
Gna12 T C 5: 140,748,367 (GRCm39) N183S probably benign Het
Gpx6 A G 13: 21,496,497 (GRCm39) N24D probably benign Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Hsd3b5 T C 3: 98,527,044 (GRCm39) Y134C probably benign Het
Ifi213 T C 1: 173,417,166 (GRCm39) I415M probably damaging Het
Ints9 C A 14: 65,253,979 (GRCm39) P278T probably damaging Het
Krt79 C T 15: 101,846,373 (GRCm39) E192K possibly damaging Het
Lrrk2 A G 15: 91,567,337 (GRCm39) N132S probably benign Het
Ltn1 T A 16: 87,213,152 (GRCm39) K470* probably null Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Mcm9 A G 10: 53,417,649 (GRCm39) M18T probably damaging Het
Med12l A G 3: 58,975,740 (GRCm39) T212A probably benign Het
Mfhas1 T C 8: 36,058,012 (GRCm39) L829P possibly damaging Het
Mgme1 T A 2: 144,121,407 (GRCm39) C288S probably benign Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Nme4 A T 17: 26,311,071 (GRCm39) W165R probably damaging Het
Nup205 T A 6: 35,196,649 (GRCm39) D1128E probably benign Het
Or2t48 A T 11: 58,420,199 (GRCm39) Y204* probably null Het
Or5ae2 T C 7: 84,505,756 (GRCm39) Y60H probably damaging Het
Pcdh1 T C 18: 38,332,538 (GRCm39) D155G possibly damaging Het
Pex12 A T 11: 83,188,648 (GRCm39) S116T probably damaging Het
Plekhh1 C T 12: 79,125,731 (GRCm39) probably benign Het
Plekhh3 A G 11: 101,054,426 (GRCm39) probably benign Het
Pnpt1 T C 11: 29,104,342 (GRCm39) M572T possibly damaging Het
Ppp1r12b T C 1: 134,765,719 (GRCm39) R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rgs14 T C 13: 55,530,651 (GRCm39) probably benign Het
Rhbdf2 A T 11: 116,491,017 (GRCm39) V645E possibly damaging Het
Robo3 A G 9: 37,333,623 (GRCm39) V696A probably benign Het
Sall1 A G 8: 89,755,344 (GRCm39) F1212L possibly damaging Het
Sdc4 T C 2: 164,270,932 (GRCm39) E109G probably benign Het
Serpind1 G T 16: 17,160,856 (GRCm39) R462L probably damaging Het
Smad9 CTTT CTT 3: 54,696,600 (GRCm39) probably benign Het
Sstr4 C A 2: 148,237,453 (GRCm39) N21K probably benign Het
Tap1 C T 17: 34,407,083 (GRCm39) A77V possibly damaging Het
Thap4 T C 1: 93,678,009 (GRCm39) E259G probably benign Het
Thra A G 11: 98,646,969 (GRCm39) N30S probably benign Het
Tmem207 A T 16: 26,343,571 (GRCm39) V27E possibly damaging Het
Top3a A G 11: 60,644,714 (GRCm39) V305A probably damaging Het
Trim59 A T 3: 68,944,971 (GRCm39) I123K probably damaging Het
Ttn T C 2: 76,691,839 (GRCm39) probably benign Het
Ubac1 T A 2: 25,897,750 (GRCm39) E290V possibly damaging Het
Unc13b T C 4: 43,258,308 (GRCm39) probably benign Het
Uri1 A T 7: 37,666,814 (GRCm39) D206E probably benign Het
Utp4 A G 8: 107,640,086 (GRCm39) H465R probably benign Het
Uvssa T C 5: 33,547,096 (GRCm39) S221P probably benign Het
Vmn1r39 T C 6: 66,782,217 (GRCm39) probably null Het
Vps39 A T 2: 120,155,878 (GRCm39) L514H probably damaging Het
Vps72 G A 3: 95,026,529 (GRCm39) R158Q possibly damaging Het
Wdr59 T C 8: 112,211,972 (GRCm39) D366G probably benign Het
Zfp366 C A 13: 99,365,000 (GRCm39) Q54K probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Gm10110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Gm10110 APN 14 90,135,677 (GRCm39) exon noncoding transcript
IGL02308:Gm10110 APN 14 90,135,031 (GRCm39) exon noncoding transcript
IGL02977:Gm10110 APN 14 90,134,768 (GRCm39) exon noncoding transcript
IGL03230:Gm10110 APN 14 90,135,733 (GRCm39) exon noncoding transcript
R0966:Gm10110 UTSW 14 90,135,555 (GRCm39) exon noncoding transcript
R1466:Gm10110 UTSW 14 90,135,511 (GRCm39) exon noncoding transcript
R1466:Gm10110 UTSW 14 90,135,511 (GRCm39) exon noncoding transcript
R1640:Gm10110 UTSW 14 90,135,679 (GRCm39) exon noncoding transcript
R1762:Gm10110 UTSW 14 90,134,825 (GRCm39) exon noncoding transcript
R2679:Gm10110 UTSW 14 90,134,852 (GRCm39) exon noncoding transcript
R3907:Gm10110 UTSW 14 90,135,583 (GRCm39) exon noncoding transcript
R4512:Gm10110 UTSW 14 90,135,151 (GRCm39) exon noncoding transcript
R4513:Gm10110 UTSW 14 90,135,151 (GRCm39) exon noncoding transcript
R4590:Gm10110 UTSW 14 90,134,982 (GRCm39) exon noncoding transcript
R4877:Gm10110 UTSW 14 90,134,785 (GRCm39) exon noncoding transcript
R5771:Gm10110 UTSW 14 90,134,675 (GRCm39) exon noncoding transcript
R6333:Gm10110 UTSW 14 90,135,733 (GRCm39) exon noncoding transcript
R6341:Gm10110 UTSW 14 90,134,144 (GRCm39) exon noncoding transcript
R8235:Gm10110 UTSW 14 90,135,677 (GRCm39) missense noncoding transcript
R8236:Gm10110 UTSW 14 90,135,677 (GRCm39) missense noncoding transcript
R8237:Gm10110 UTSW 14 90,135,677 (GRCm39) missense noncoding transcript
R8281:Gm10110 UTSW 14 90,135,677 (GRCm39) missense noncoding transcript
R8282:Gm10110 UTSW 14 90,135,677 (GRCm39) missense noncoding transcript
R8283:Gm10110 UTSW 14 90,135,677 (GRCm39) missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- GTGCACGGCCTACAAATATGG -3'
(R):5'- ATGAGAACGGCTCTAAGGGC -3'

Sequencing Primer
(F):5'- GCACGGCCTACAAATATGGCTTTC -3'
(R):5'- TTGTTCACTTCGAGACCCAAGAGG -3'
Posted On 2014-06-23