Incidental Mutation 'R1839:Ltn1'
ID 205645
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Name listerin E3 ubiquitin protein ligase 1
Synonyms Listerin, Zfp294, Rnf160, 4930528H02Rik
MMRRC Submission 045015-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1839 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 87173539-87229500 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 87213152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 470 (K470*)
Ref Sequence ENSEMBL: ENSMUSP00000156299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]
AlphaFold Q6A009
Predicted Effect probably null
Transcript: ENSMUST00000039449
AA Change: K470*
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: K470*

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083713
Predicted Effect probably null
Transcript: ENSMUST00000232095
AA Change: K470*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,369 (GRCm39) T403A probably damaging Het
Acat3 T A 17: 13,147,493 (GRCm39) R175* probably null Het
Adam1b C A 5: 121,639,104 (GRCm39) C647F probably damaging Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adcy2 C T 13: 68,837,380 (GRCm39) probably null Het
Adcy5 A T 16: 35,069,310 (GRCm39) N426I probably damaging Het
Adgre1 T C 17: 57,748,299 (GRCm39) S500P probably benign Het
Aloxe3 A G 11: 69,020,911 (GRCm39) Y212C probably damaging Het
Ap3d1 A G 10: 80,562,942 (GRCm39) S180P probably damaging Het
Arhgap20 C T 9: 51,760,626 (GRCm39) R790W probably damaging Het
Atp8b4 C A 2: 126,203,702 (GRCm39) A757S possibly damaging Het
Begain G A 12: 109,001,249 (GRCm39) probably benign Het
Ccdc141 T C 2: 76,842,009 (GRCm39) E1474G probably benign Het
Ccdc88b A G 19: 6,831,477 (GRCm39) probably benign Het
Ccnk A G 12: 108,161,333 (GRCm39) T195A probably damaging Het
Cd55b C A 1: 130,341,842 (GRCm39) C265F probably damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Cenpt T C 8: 106,575,646 (GRCm39) S190G possibly damaging Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Cxxc4 C A 3: 133,946,414 (GRCm39) H332N probably damaging Het
Cyp24a1 T C 2: 170,338,661 (GRCm39) I12V probably benign Het
Cyp3a57 T A 5: 145,318,111 (GRCm39) L364Q probably damaging Het
Ddi2 T C 4: 141,440,837 (GRCm39) I47V probably benign Het
Ddx5 A T 11: 106,675,723 (GRCm39) D322E probably benign Het
Dhx40 A G 11: 86,680,123 (GRCm39) C405R possibly damaging Het
Emc1 T C 4: 139,087,796 (GRCm39) F100S probably damaging Het
Exoc2 T C 13: 31,090,480 (GRCm39) probably benign Het
Gm10110 A T 14: 90,135,272 (GRCm39) noncoding transcript Het
Gm17332 T C 11: 31,132,386 (GRCm39) H26R possibly damaging Het
Gna12 T C 5: 140,748,367 (GRCm39) N183S probably benign Het
Gpx6 A G 13: 21,496,497 (GRCm39) N24D probably benign Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Hsd3b5 T C 3: 98,527,044 (GRCm39) Y134C probably benign Het
Ifi213 T C 1: 173,417,166 (GRCm39) I415M probably damaging Het
Ints9 C A 14: 65,253,979 (GRCm39) P278T probably damaging Het
Krt79 C T 15: 101,846,373 (GRCm39) E192K possibly damaging Het
Lrrk2 A G 15: 91,567,337 (GRCm39) N132S probably benign Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Mcm9 A G 10: 53,417,649 (GRCm39) M18T probably damaging Het
Med12l A G 3: 58,975,740 (GRCm39) T212A probably benign Het
Mfhas1 T C 8: 36,058,012 (GRCm39) L829P possibly damaging Het
Mgme1 T A 2: 144,121,407 (GRCm39) C288S probably benign Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Nme4 A T 17: 26,311,071 (GRCm39) W165R probably damaging Het
Nup205 T A 6: 35,196,649 (GRCm39) D1128E probably benign Het
Or2t48 A T 11: 58,420,199 (GRCm39) Y204* probably null Het
Or5ae2 T C 7: 84,505,756 (GRCm39) Y60H probably damaging Het
Pcdh1 T C 18: 38,332,538 (GRCm39) D155G possibly damaging Het
Pex12 A T 11: 83,188,648 (GRCm39) S116T probably damaging Het
Plekhh1 C T 12: 79,125,731 (GRCm39) probably benign Het
Plekhh3 A G 11: 101,054,426 (GRCm39) probably benign Het
Pnpt1 T C 11: 29,104,342 (GRCm39) M572T possibly damaging Het
Ppp1r12b T C 1: 134,765,719 (GRCm39) R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rgs14 T C 13: 55,530,651 (GRCm39) probably benign Het
Rhbdf2 A T 11: 116,491,017 (GRCm39) V645E possibly damaging Het
Robo3 A G 9: 37,333,623 (GRCm39) V696A probably benign Het
Sall1 A G 8: 89,755,344 (GRCm39) F1212L possibly damaging Het
Sdc4 T C 2: 164,270,932 (GRCm39) E109G probably benign Het
Serpind1 G T 16: 17,160,856 (GRCm39) R462L probably damaging Het
Smad9 CTTT CTT 3: 54,696,600 (GRCm39) probably benign Het
Sstr4 C A 2: 148,237,453 (GRCm39) N21K probably benign Het
Tap1 C T 17: 34,407,083 (GRCm39) A77V possibly damaging Het
Thap4 T C 1: 93,678,009 (GRCm39) E259G probably benign Het
Thra A G 11: 98,646,969 (GRCm39) N30S probably benign Het
Tmem207 A T 16: 26,343,571 (GRCm39) V27E possibly damaging Het
Top3a A G 11: 60,644,714 (GRCm39) V305A probably damaging Het
Trim59 A T 3: 68,944,971 (GRCm39) I123K probably damaging Het
Ttn T C 2: 76,691,839 (GRCm39) probably benign Het
Ubac1 T A 2: 25,897,750 (GRCm39) E290V possibly damaging Het
Unc13b T C 4: 43,258,308 (GRCm39) probably benign Het
Uri1 A T 7: 37,666,814 (GRCm39) D206E probably benign Het
Utp4 A G 8: 107,640,086 (GRCm39) H465R probably benign Het
Uvssa T C 5: 33,547,096 (GRCm39) S221P probably benign Het
Vmn1r39 T C 6: 66,782,217 (GRCm39) probably null Het
Vps39 A T 2: 120,155,878 (GRCm39) L514H probably damaging Het
Vps72 G A 3: 95,026,529 (GRCm39) R158Q possibly damaging Het
Wdr59 T C 8: 112,211,972 (GRCm39) D366G probably benign Het
Zfp366 C A 13: 99,365,000 (GRCm39) Q54K probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87,215,378 (GRCm39) missense probably benign 0.03
IGL01139:Ltn1 APN 16 87,212,897 (GRCm39) missense probably benign 0.04
IGL01359:Ltn1 APN 16 87,202,581 (GRCm39) splice site probably benign
IGL01503:Ltn1 APN 16 87,217,695 (GRCm39) critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87,178,359 (GRCm39) missense probably benign 0.00
IGL02437:Ltn1 APN 16 87,194,889 (GRCm39) missense probably benign 0.04
IGL02658:Ltn1 APN 16 87,212,662 (GRCm39) missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87,206,185 (GRCm39) splice site probably null
IGL02899:Ltn1 APN 16 87,179,547 (GRCm39) missense probably benign 0.34
IGL02902:Ltn1 APN 16 87,176,693 (GRCm39) missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87,212,832 (GRCm39) missense probably benign 0.00
IGL03392:Ltn1 APN 16 87,222,499 (GRCm39) missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87,202,509 (GRCm39) missense probably benign 0.10
PIT4305001:Ltn1 UTSW 16 87,217,211 (GRCm39) missense probably damaging 1.00
PIT4366001:Ltn1 UTSW 16 87,177,728 (GRCm39) nonsense probably null
R0126:Ltn1 UTSW 16 87,222,528 (GRCm39) missense probably benign 0.00
R0164:Ltn1 UTSW 16 87,202,407 (GRCm39) splice site probably benign
R0165:Ltn1 UTSW 16 87,202,407 (GRCm39) splice site probably benign
R0280:Ltn1 UTSW 16 87,194,726 (GRCm39) missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87,212,898 (GRCm39) missense probably benign 0.01
R0733:Ltn1 UTSW 16 87,209,395 (GRCm39) missense probably benign 0.01
R1034:Ltn1 UTSW 16 87,194,025 (GRCm39) splice site probably null
R1252:Ltn1 UTSW 16 87,212,918 (GRCm39) missense probably benign 0.00
R1524:Ltn1 UTSW 16 87,178,444 (GRCm39) missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87,208,669 (GRCm39) missense possibly damaging 0.86
R1826:Ltn1 UTSW 16 87,212,504 (GRCm39) missense probably damaging 1.00
R1831:Ltn1 UTSW 16 87,197,034 (GRCm39) missense possibly damaging 0.94
R1860:Ltn1 UTSW 16 87,213,231 (GRCm39) missense probably benign 0.06
R1997:Ltn1 UTSW 16 87,178,525 (GRCm39) missense probably damaging 1.00
R2109:Ltn1 UTSW 16 87,212,530 (GRCm39) missense probably benign 0.03
R2134:Ltn1 UTSW 16 87,179,601 (GRCm39) missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87,179,601 (GRCm39) missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87,224,535 (GRCm39) missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87,229,312 (GRCm39) critical splice donor site probably null
R2376:Ltn1 UTSW 16 87,217,695 (GRCm39) critical splice donor site probably null
R3054:Ltn1 UTSW 16 87,200,961 (GRCm39) missense probably benign 0.32
R3404:Ltn1 UTSW 16 87,213,103 (GRCm39) missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87,213,103 (GRCm39) missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87,217,787 (GRCm39) missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87,213,118 (GRCm39) missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87,213,118 (GRCm39) missense possibly damaging 0.84
R4067:Ltn1 UTSW 16 87,213,118 (GRCm39) missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87,194,876 (GRCm39) missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87,202,502 (GRCm39) missense probably benign 0.17
R4535:Ltn1 UTSW 16 87,223,174 (GRCm39) missense probably damaging 1.00
R4581:Ltn1 UTSW 16 87,198,912 (GRCm39) critical splice donor site probably null
R4669:Ltn1 UTSW 16 87,215,375 (GRCm39) missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87,215,382 (GRCm39) missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87,176,582 (GRCm39) missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87,195,697 (GRCm39) nonsense probably null
R4961:Ltn1 UTSW 16 87,194,679 (GRCm39) missense probably benign
R4992:Ltn1 UTSW 16 87,202,475 (GRCm39) missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87,224,628 (GRCm39) missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87,212,899 (GRCm39) missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87,212,569 (GRCm39) missense probably benign 0.17
R5907:Ltn1 UTSW 16 87,178,391 (GRCm39) missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87,224,677 (GRCm39) missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87,212,698 (GRCm39) missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87,208,662 (GRCm39) missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87,217,194 (GRCm39) missense probably benign
R6481:Ltn1 UTSW 16 87,175,868 (GRCm39) missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87,217,074 (GRCm39) missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87,194,679 (GRCm39) missense probably benign
R6969:Ltn1 UTSW 16 87,212,578 (GRCm39) missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87,220,361 (GRCm39) missense probably benign
R7038:Ltn1 UTSW 16 87,221,759 (GRCm39) missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87,224,491 (GRCm39) missense probably damaging 0.98
R7152:Ltn1 UTSW 16 87,224,529 (GRCm39) missense probably damaging 1.00
R7180:Ltn1 UTSW 16 87,215,382 (GRCm39) missense probably damaging 0.98
R7247:Ltn1 UTSW 16 87,206,275 (GRCm39) missense probably benign 0.00
R7454:Ltn1 UTSW 16 87,194,700 (GRCm39) missense probably benign 0.03
R7471:Ltn1 UTSW 16 87,194,787 (GRCm39) missense probably benign
R7511:Ltn1 UTSW 16 87,205,716 (GRCm39) missense possibly damaging 0.63
R7691:Ltn1 UTSW 16 87,195,574 (GRCm39) missense probably damaging 0.99
R7702:Ltn1 UTSW 16 87,223,166 (GRCm39) missense probably damaging 1.00
R7761:Ltn1 UTSW 16 87,208,681 (GRCm39) missense probably benign
R8002:Ltn1 UTSW 16 87,212,835 (GRCm39) missense probably benign 0.17
R8101:Ltn1 UTSW 16 87,215,385 (GRCm39) missense probably damaging 1.00
R8142:Ltn1 UTSW 16 87,178,529 (GRCm39) missense probably benign 0.21
R8214:Ltn1 UTSW 16 87,177,691 (GRCm39) missense probably benign 0.02
R8674:Ltn1 UTSW 16 87,195,673 (GRCm39) missense probably benign
R8783:Ltn1 UTSW 16 87,207,247 (GRCm39) missense probably benign 0.30
R8839:Ltn1 UTSW 16 87,215,390 (GRCm39) missense probably damaging 1.00
R8885:Ltn1 UTSW 16 87,178,433 (GRCm39) missense probably damaging 1.00
R8889:Ltn1 UTSW 16 87,229,230 (GRCm39) intron probably benign
R8892:Ltn1 UTSW 16 87,229,230 (GRCm39) intron probably benign
R8919:Ltn1 UTSW 16 87,178,381 (GRCm39) missense probably damaging 0.98
R8970:Ltn1 UTSW 16 87,212,926 (GRCm39) missense probably benign
R9113:Ltn1 UTSW 16 87,224,532 (GRCm39) missense probably damaging 1.00
R9206:Ltn1 UTSW 16 87,197,298 (GRCm39) missense probably benign 0.00
R9208:Ltn1 UTSW 16 87,197,298 (GRCm39) missense probably benign 0.00
R9234:Ltn1 UTSW 16 87,194,089 (GRCm39) missense probably damaging 0.98
R9421:Ltn1 UTSW 16 87,215,375 (GRCm39) missense possibly damaging 0.90
R9558:Ltn1 UTSW 16 87,220,295 (GRCm39) missense probably benign 0.05
R9654:Ltn1 UTSW 16 87,207,227 (GRCm39) missense probably benign 0.00
R9738:Ltn1 UTSW 16 87,222,524 (GRCm39) missense probably damaging 1.00
X0028:Ltn1 UTSW 16 87,199,022 (GRCm39) missense probably benign 0.01
Z1177:Ltn1 UTSW 16 87,198,925 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTATATTGATGGCAAACCTGACCTG -3'
(R):5'- AGGAGGCTTTATACTGCTTTAACTTTG -3'

Sequencing Primer
(F):5'- GCAAACCTGACCTGAGCAGTTTTC -3'
(R):5'- TCAAAGACTCAGGACTGC -3'
Posted On 2014-06-23