Incidental Mutation 'R1839:Zfp523'
ID205648
Institutional Source Beutler Lab
Gene Symbol Zfp523
Ensembl Gene ENSMUSG00000024220
Gene Namezinc finger protein 523
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R1839 (G1)
Quality Score134
Status Validated
Chromosome17
Chromosomal Location28177207-28205886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28194993 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 34 (I34N)
Ref Sequence ENSEMBL: ENSMUSP00000073226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002318] [ENSMUST00000073534] [ENSMUST00000133868]
Predicted Effect probably damaging
Transcript: ENSMUST00000002318
AA Change: I34N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002318
Gene: ENSMUSG00000024220
AA Change: I34N

DomainStartEndE-ValueType
internal_repeat_1 7 45 7.42e-6 PROSPERO
internal_repeat_1 60 99 7.42e-6 PROSPERO
low complexity region 116 129 N/A INTRINSIC
ZnF_C2H2 165 189 7.15e-2 SMART
ZnF_C2H2 195 219 3.16e-3 SMART
ZnF_C2H2 225 249 8.47e-4 SMART
ZnF_C2H2 255 279 2.24e-3 SMART
ZnF_C2H2 285 309 3.44e-4 SMART
ZnF_C2H2 315 339 1.69e-3 SMART
ZnF_C2H2 345 368 5.06e-2 SMART
low complexity region 375 396 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073534
AA Change: I34N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073226
Gene: ENSMUSG00000024220
AA Change: I34N

DomainStartEndE-ValueType
internal_repeat_1 7 45 7.42e-6 PROSPERO
internal_repeat_1 60 99 7.42e-6 PROSPERO
low complexity region 116 129 N/A INTRINSIC
ZnF_C2H2 165 189 7.15e-2 SMART
ZnF_C2H2 195 219 3.16e-3 SMART
ZnF_C2H2 225 249 8.47e-4 SMART
ZnF_C2H2 255 279 2.24e-3 SMART
ZnF_C2H2 285 309 3.44e-4 SMART
ZnF_C2H2 315 339 1.69e-3 SMART
ZnF_C2H2 345 368 5.06e-2 SMART
low complexity region 375 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133868
SMART Domains Protein: ENSMUSP00000123127
Gene: ENSMUSG00000024220

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
ZnF_C2H2 84 108 7.15e-2 SMART
ZnF_C2H2 114 138 3.16e-3 SMART
ZnF_C2H2 144 168 8.47e-4 SMART
ZnF_C2H2 174 198 3.44e-4 SMART
ZnF_C2H2 204 228 1.69e-3 SMART
ZnF_C2H2 234 257 5.06e-2 SMART
low complexity region 264 285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161275
Meta Mutation Damage Score 0.7564 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Zfp523
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Zfp523 APN 17 28201049 missense possibly damaging 0.95
IGL01405:Zfp523 APN 17 28204506 missense probably damaging 0.99
IGL02430:Zfp523 APN 17 28195139 unclassified probably benign
R0496:Zfp523 UTSW 17 28200445 missense possibly damaging 0.83
R1533:Zfp523 UTSW 17 28204499 missense probably benign 0.18
R1837:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R1838:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R2023:Zfp523 UTSW 17 28201004 unclassified probably benign
R2104:Zfp523 UTSW 17 28195216 missense probably benign 0.31
R2403:Zfp523 UTSW 17 28195209 missense probably damaging 1.00
R2864:Zfp523 UTSW 17 28202540 missense probably benign 0.00
R4157:Zfp523 UTSW 17 28202283 missense probably benign 0.06
R4214:Zfp523 UTSW 17 28201029 missense probably benign 0.04
R4771:Zfp523 UTSW 17 28201338 splice site probably null
R5869:Zfp523 UTSW 17 28194993 missense probably benign 0.37
R5950:Zfp523 UTSW 17 28202558 missense probably benign 0.06
R6443:Zfp523 UTSW 17 28201407 missense probably damaging 0.99
R6679:Zfp523 UTSW 17 28202220 missense probably damaging 1.00
R6694:Zfp523 UTSW 17 28200472 missense probably damaging 1.00
R7669:Zfp523 UTSW 17 28201041 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCAGGATGTTTCTCCTC -3'
(R):5'- GGGCTGACCATCTTCAAAGGAG -3'

Sequencing Primer
(F):5'- CCTCCAGACTGAGGCTTAAGAG -3'
(R):5'- TCTTCAAAGGAGAAAGACTCTGC -3'
Posted On2014-06-23