Incidental Mutation 'R1839:Ccdc88b'
ID 205652
Institutional Source Beutler Lab
Gene Symbol Ccdc88b
Ensembl Gene ENSMUSG00000047810
Gene Name coiled-coil domain containing 88B
Synonyms 2610041P08Rik
MMRRC Submission 045015-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1839 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 6821991-6835579 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 6831477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113440]
AlphaFold Q4QRL3
Predicted Effect probably benign
Transcript: ENSMUST00000113440
SMART Domains Protein: ENSMUSP00000109067
Gene: ENSMUSG00000047810

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:HOOK 91 503 1.2e-16 PFAM
coiled coil region 731 1308 N/A INTRINSIC
low complexity region 1420 1429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook-related protein family. Members of this family are characterized by an N-terminal potential microtubule binding domain, a central coiled-coiled and a C-terminal Hook-related domain. The encoded protein may be involved in linking organelles to microtubules. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null ENU-induced allele exhibit decreased susceptibility to P. berghei infection with reduced T cell proliferation, decreased cytokine secretion and increased myeloid cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,203,369 (GRCm39) T403A probably damaging Het
Acat3 T A 17: 13,147,493 (GRCm39) R175* probably null Het
Adam1b C A 5: 121,639,104 (GRCm39) C647F probably damaging Het
Adam28 T C 14: 68,876,659 (GRCm39) N197S possibly damaging Het
Adcy2 C T 13: 68,837,380 (GRCm39) probably null Het
Adcy5 A T 16: 35,069,310 (GRCm39) N426I probably damaging Het
Adgre1 T C 17: 57,748,299 (GRCm39) S500P probably benign Het
Aloxe3 A G 11: 69,020,911 (GRCm39) Y212C probably damaging Het
Ap3d1 A G 10: 80,562,942 (GRCm39) S180P probably damaging Het
Arhgap20 C T 9: 51,760,626 (GRCm39) R790W probably damaging Het
Atp8b4 C A 2: 126,203,702 (GRCm39) A757S possibly damaging Het
Begain G A 12: 109,001,249 (GRCm39) probably benign Het
Ccdc141 T C 2: 76,842,009 (GRCm39) E1474G probably benign Het
Ccnk A G 12: 108,161,333 (GRCm39) T195A probably damaging Het
Cd55b C A 1: 130,341,842 (GRCm39) C265F probably damaging Het
Celsr3 A G 9: 108,707,105 (GRCm39) H1196R probably benign Het
Cenpt T C 8: 106,575,646 (GRCm39) S190G possibly damaging Het
Chd8 T C 14: 52,442,340 (GRCm39) S2077G probably benign Het
Col6a5 G A 9: 105,742,032 (GRCm39) H2296Y probably benign Het
Cxxc4 C A 3: 133,946,414 (GRCm39) H332N probably damaging Het
Cyp24a1 T C 2: 170,338,661 (GRCm39) I12V probably benign Het
Cyp3a57 T A 5: 145,318,111 (GRCm39) L364Q probably damaging Het
Ddi2 T C 4: 141,440,837 (GRCm39) I47V probably benign Het
Ddx5 A T 11: 106,675,723 (GRCm39) D322E probably benign Het
Dhx40 A G 11: 86,680,123 (GRCm39) C405R possibly damaging Het
Emc1 T C 4: 139,087,796 (GRCm39) F100S probably damaging Het
Exoc2 T C 13: 31,090,480 (GRCm39) probably benign Het
Gm10110 A T 14: 90,135,272 (GRCm39) noncoding transcript Het
Gm17332 T C 11: 31,132,386 (GRCm39) H26R possibly damaging Het
Gna12 T C 5: 140,748,367 (GRCm39) N183S probably benign Het
Gpx6 A G 13: 21,496,497 (GRCm39) N24D probably benign Het
Gsdma3 C T 11: 98,520,684 (GRCm39) A105V probably benign Het
Hsd3b5 T C 3: 98,527,044 (GRCm39) Y134C probably benign Het
Ifi213 T C 1: 173,417,166 (GRCm39) I415M probably damaging Het
Ints9 C A 14: 65,253,979 (GRCm39) P278T probably damaging Het
Krt79 C T 15: 101,846,373 (GRCm39) E192K possibly damaging Het
Lrrk2 A G 15: 91,567,337 (GRCm39) N132S probably benign Het
Ltn1 T A 16: 87,213,152 (GRCm39) K470* probably null Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Mcm9 A G 10: 53,417,649 (GRCm39) M18T probably damaging Het
Med12l A G 3: 58,975,740 (GRCm39) T212A probably benign Het
Mfhas1 T C 8: 36,058,012 (GRCm39) L829P possibly damaging Het
Mgme1 T A 2: 144,121,407 (GRCm39) C288S probably benign Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myh7 T C 14: 55,210,637 (GRCm39) N1725S possibly damaging Het
Naa80 G A 9: 107,460,216 (GRCm39) R37H possibly damaging Het
Nme4 A T 17: 26,311,071 (GRCm39) W165R probably damaging Het
Nup205 T A 6: 35,196,649 (GRCm39) D1128E probably benign Het
Or2t48 A T 11: 58,420,199 (GRCm39) Y204* probably null Het
Or5ae2 T C 7: 84,505,756 (GRCm39) Y60H probably damaging Het
Pcdh1 T C 18: 38,332,538 (GRCm39) D155G possibly damaging Het
Pex12 A T 11: 83,188,648 (GRCm39) S116T probably damaging Het
Plekhh1 C T 12: 79,125,731 (GRCm39) probably benign Het
Plekhh3 A G 11: 101,054,426 (GRCm39) probably benign Het
Pnpt1 T C 11: 29,104,342 (GRCm39) M572T possibly damaging Het
Ppp1r12b T C 1: 134,765,719 (GRCm39) R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Rgs14 T C 13: 55,530,651 (GRCm39) probably benign Het
Rhbdf2 A T 11: 116,491,017 (GRCm39) V645E possibly damaging Het
Robo3 A G 9: 37,333,623 (GRCm39) V696A probably benign Het
Sall1 A G 8: 89,755,344 (GRCm39) F1212L possibly damaging Het
Sdc4 T C 2: 164,270,932 (GRCm39) E109G probably benign Het
Serpind1 G T 16: 17,160,856 (GRCm39) R462L probably damaging Het
Smad9 CTTT CTT 3: 54,696,600 (GRCm39) probably benign Het
Sstr4 C A 2: 148,237,453 (GRCm39) N21K probably benign Het
Tap1 C T 17: 34,407,083 (GRCm39) A77V possibly damaging Het
Thap4 T C 1: 93,678,009 (GRCm39) E259G probably benign Het
Thra A G 11: 98,646,969 (GRCm39) N30S probably benign Het
Tmem207 A T 16: 26,343,571 (GRCm39) V27E possibly damaging Het
Top3a A G 11: 60,644,714 (GRCm39) V305A probably damaging Het
Trim59 A T 3: 68,944,971 (GRCm39) I123K probably damaging Het
Ttn T C 2: 76,691,839 (GRCm39) probably benign Het
Ubac1 T A 2: 25,897,750 (GRCm39) E290V possibly damaging Het
Unc13b T C 4: 43,258,308 (GRCm39) probably benign Het
Uri1 A T 7: 37,666,814 (GRCm39) D206E probably benign Het
Utp4 A G 8: 107,640,086 (GRCm39) H465R probably benign Het
Uvssa T C 5: 33,547,096 (GRCm39) S221P probably benign Het
Vmn1r39 T C 6: 66,782,217 (GRCm39) probably null Het
Vps39 A T 2: 120,155,878 (GRCm39) L514H probably damaging Het
Vps72 G A 3: 95,026,529 (GRCm39) R158Q possibly damaging Het
Wdr59 T C 8: 112,211,972 (GRCm39) D366G probably benign Het
Zfp366 C A 13: 99,365,000 (GRCm39) Q54K probably damaging Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Ccdc88b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Ccdc88b APN 19 6,822,454 (GRCm39) missense probably damaging 1.00
IGL01637:Ccdc88b APN 19 6,824,078 (GRCm39) missense probably benign 0.13
IGL02201:Ccdc88b APN 19 6,823,999 (GRCm39) missense probably damaging 1.00
IGL02260:Ccdc88b APN 19 6,832,717 (GRCm39) splice site probably benign
IGL02276:Ccdc88b APN 19 6,833,475 (GRCm39) critical splice donor site probably null
IGL02412:Ccdc88b APN 19 6,824,012 (GRCm39) missense probably damaging 1.00
IGL02420:Ccdc88b APN 19 6,834,317 (GRCm39) missense probably damaging 1.00
IGL02990:Ccdc88b APN 19 6,824,777 (GRCm39) missense probably damaging 1.00
R0031:Ccdc88b UTSW 19 6,831,151 (GRCm39) missense possibly damaging 0.93
R0544:Ccdc88b UTSW 19 6,834,634 (GRCm39) missense probably damaging 1.00
R0727:Ccdc88b UTSW 19 6,831,582 (GRCm39) missense probably benign
R0920:Ccdc88b UTSW 19 6,824,017 (GRCm39) missense probably benign
R0975:Ccdc88b UTSW 19 6,823,993 (GRCm39) missense probably damaging 1.00
R1170:Ccdc88b UTSW 19 6,830,581 (GRCm39) missense probably damaging 1.00
R1363:Ccdc88b UTSW 19 6,827,739 (GRCm39) missense possibly damaging 0.55
R1471:Ccdc88b UTSW 19 6,831,391 (GRCm39) missense probably benign
R1605:Ccdc88b UTSW 19 6,827,837 (GRCm39) missense probably benign 0.06
R1752:Ccdc88b UTSW 19 6,830,690 (GRCm39) missense probably benign 0.02
R1832:Ccdc88b UTSW 19 6,830,900 (GRCm39) nonsense probably null
R1917:Ccdc88b UTSW 19 6,826,594 (GRCm39) missense probably damaging 1.00
R2167:Ccdc88b UTSW 19 6,831,452 (GRCm39) missense possibly damaging 0.52
R4012:Ccdc88b UTSW 19 6,826,359 (GRCm39) missense probably damaging 0.98
R4350:Ccdc88b UTSW 19 6,827,640 (GRCm39) missense probably damaging 0.97
R4427:Ccdc88b UTSW 19 6,827,940 (GRCm39) missense probably damaging 0.99
R4676:Ccdc88b UTSW 19 6,830,368 (GRCm39) missense probably benign 0.00
R4677:Ccdc88b UTSW 19 6,825,636 (GRCm39) missense probably damaging 0.98
R4720:Ccdc88b UTSW 19 6,835,083 (GRCm39) missense probably damaging 1.00
R4725:Ccdc88b UTSW 19 6,834,481 (GRCm39) missense probably damaging 1.00
R4747:Ccdc88b UTSW 19 6,833,509 (GRCm39) missense probably damaging 1.00
R5092:Ccdc88b UTSW 19 6,825,600 (GRCm39) missense probably damaging 0.99
R5403:Ccdc88b UTSW 19 6,835,108 (GRCm39) missense unknown
R5448:Ccdc88b UTSW 19 6,831,948 (GRCm39) missense probably damaging 1.00
R5771:Ccdc88b UTSW 19 6,831,203 (GRCm39) missense probably benign
R5783:Ccdc88b UTSW 19 6,831,284 (GRCm39) missense probably benign 0.19
R5988:Ccdc88b UTSW 19 6,833,348 (GRCm39) missense probably damaging 1.00
R6328:Ccdc88b UTSW 19 6,826,406 (GRCm39) missense probably damaging 1.00
R6459:Ccdc88b UTSW 19 6,832,246 (GRCm39) missense possibly damaging 0.92
R6773:Ccdc88b UTSW 19 6,826,409 (GRCm39) missense possibly damaging 0.71
R7073:Ccdc88b UTSW 19 6,831,330 (GRCm39) missense probably benign 0.34
R7707:Ccdc88b UTSW 19 6,834,837 (GRCm39) missense probably benign 0.23
R7810:Ccdc88b UTSW 19 6,826,454 (GRCm39) missense probably benign
R8298:Ccdc88b UTSW 19 6,827,649 (GRCm39) missense probably damaging 0.97
R8349:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8449:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8481:Ccdc88b UTSW 19 6,831,900 (GRCm39) missense probably damaging 1.00
R8506:Ccdc88b UTSW 19 6,824,690 (GRCm39) missense probably damaging 0.99
R8714:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8715:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8717:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8753:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8754:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8774:Ccdc88b UTSW 19 6,825,090 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Ccdc88b UTSW 19 6,825,090 (GRCm39) missense probably damaging 1.00
R8787:Ccdc88b UTSW 19 6,824,791 (GRCm39) missense probably damaging 1.00
R8896:Ccdc88b UTSW 19 6,831,203 (GRCm39) missense probably benign
R9049:Ccdc88b UTSW 19 6,826,442 (GRCm39) missense probably benign 0.37
R9100:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9113:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9197:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9198:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9198:Ccdc88b UTSW 19 6,831,268 (GRCm39) missense possibly damaging 0.92
R9202:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9323:Ccdc88b UTSW 19 6,826,475 (GRCm39) missense probably damaging 1.00
R9334:Ccdc88b UTSW 19 6,833,541 (GRCm39) missense possibly damaging 0.50
R9385:Ccdc88b UTSW 19 6,833,533 (GRCm39) missense probably benign 0.13
R9441:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9442:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9748:Ccdc88b UTSW 19 6,831,461 (GRCm39) missense probably damaging 1.00
R9766:Ccdc88b UTSW 19 6,833,096 (GRCm39) missense probably damaging 1.00
X0021:Ccdc88b UTSW 19 6,831,199 (GRCm39) missense probably benign
Z1176:Ccdc88b UTSW 19 6,827,108 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCTGAGAACACTTGGGTGAC -3'
(R):5'- CACCCTCACTGCAAGATGAG -3'

Sequencing Primer
(F):5'- ACCTTGTGATGTCAGAGTATGATGC -3'
(R):5'- CCCTCACTGCAAGATGAGGTGAG -3'
Posted On 2014-06-23