Incidental Mutation 'R1839:Ccdc88b'
ID 205652
Institutional Source Beutler Lab
Gene Symbol Ccdc88b
Ensembl Gene ENSMUSG00000047810
Gene Name coiled-coil domain containing 88B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1839 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 6844623-6858211 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 6854109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113440]
AlphaFold Q4QRL3
Predicted Effect probably benign
Transcript: ENSMUST00000113440
SMART Domains Protein: ENSMUSP00000109067
Gene: ENSMUSG00000047810

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:HOOK 91 503 1.2e-16 PFAM
coiled coil region 731 1308 N/A INTRINSIC
low complexity region 1420 1429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook-related protein family. Members of this family are characterized by an N-terminal potential microtubule binding domain, a central coiled-coiled and a C-terminal Hook-related domain. The encoded protein may be involved in linking organelles to microtubules. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null ENU-induced allele exhibit decreased susceptibility to P. berghei infection with reduced T cell proliferation, decreased cytokine secretion and increased myeloid cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Ccdc88b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Ccdc88b APN 19 6845086 missense probably damaging 1.00
IGL01637:Ccdc88b APN 19 6846710 missense probably benign 0.13
IGL02201:Ccdc88b APN 19 6846631 missense probably damaging 1.00
IGL02260:Ccdc88b APN 19 6855349 splice site probably benign
IGL02276:Ccdc88b APN 19 6856107 critical splice donor site probably null
IGL02412:Ccdc88b APN 19 6846644 missense probably damaging 1.00
IGL02420:Ccdc88b APN 19 6856949 missense probably damaging 1.00
IGL02990:Ccdc88b APN 19 6847409 missense probably damaging 1.00
R0031:Ccdc88b UTSW 19 6853783 missense possibly damaging 0.93
R0544:Ccdc88b UTSW 19 6857266 missense probably damaging 1.00
R0727:Ccdc88b UTSW 19 6854214 missense probably benign
R0920:Ccdc88b UTSW 19 6846649 missense probably benign
R0975:Ccdc88b UTSW 19 6846625 missense probably damaging 1.00
R1170:Ccdc88b UTSW 19 6853213 missense probably damaging 1.00
R1363:Ccdc88b UTSW 19 6850371 missense possibly damaging 0.55
R1471:Ccdc88b UTSW 19 6854023 missense probably benign
R1605:Ccdc88b UTSW 19 6850469 missense probably benign 0.06
R1752:Ccdc88b UTSW 19 6853322 missense probably benign 0.02
R1832:Ccdc88b UTSW 19 6853532 nonsense probably null
R1917:Ccdc88b UTSW 19 6849226 missense probably damaging 1.00
R2167:Ccdc88b UTSW 19 6854084 missense possibly damaging 0.52
R4012:Ccdc88b UTSW 19 6848991 missense probably damaging 0.98
R4350:Ccdc88b UTSW 19 6850272 missense probably damaging 0.97
R4427:Ccdc88b UTSW 19 6850572 missense probably damaging 0.99
R4676:Ccdc88b UTSW 19 6853000 missense probably benign 0.00
R4677:Ccdc88b UTSW 19 6848268 missense probably damaging 0.98
R4720:Ccdc88b UTSW 19 6857715 missense probably damaging 1.00
R4725:Ccdc88b UTSW 19 6857113 missense probably damaging 1.00
R4747:Ccdc88b UTSW 19 6856141 missense probably damaging 1.00
R5092:Ccdc88b UTSW 19 6848232 missense probably damaging 0.99
R5403:Ccdc88b UTSW 19 6857740 missense unknown
R5448:Ccdc88b UTSW 19 6854580 missense probably damaging 1.00
R5771:Ccdc88b UTSW 19 6853835 missense probably benign
R5783:Ccdc88b UTSW 19 6853916 missense probably benign 0.19
R5988:Ccdc88b UTSW 19 6855980 missense probably damaging 1.00
R6328:Ccdc88b UTSW 19 6849038 missense probably damaging 1.00
R6459:Ccdc88b UTSW 19 6854878 missense possibly damaging 0.92
R6773:Ccdc88b UTSW 19 6849041 missense possibly damaging 0.71
R7073:Ccdc88b UTSW 19 6853962 missense probably benign 0.34
R7707:Ccdc88b UTSW 19 6857469 missense probably benign 0.23
R7810:Ccdc88b UTSW 19 6849086 missense probably benign
R8298:Ccdc88b UTSW 19 6850281 missense probably damaging 0.97
R8349:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8449:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8481:Ccdc88b UTSW 19 6854532 missense probably damaging 1.00
R8506:Ccdc88b UTSW 19 6847322 missense probably damaging 0.99
R8714:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8715:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8717:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8753:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8754:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R8774:Ccdc88b UTSW 19 6847722 missense probably damaging 1.00
R8774-TAIL:Ccdc88b UTSW 19 6847722 missense probably damaging 1.00
R8787:Ccdc88b UTSW 19 6847423 missense probably damaging 1.00
R8896:Ccdc88b UTSW 19 6853835 missense probably benign
R9049:Ccdc88b UTSW 19 6849074 missense probably benign 0.37
R9100:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9113:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9197:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9198:Ccdc88b UTSW 19 6853900 missense possibly damaging 0.92
R9198:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9202:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9323:Ccdc88b UTSW 19 6849107 missense probably damaging 1.00
R9334:Ccdc88b UTSW 19 6856173 missense possibly damaging 0.50
R9385:Ccdc88b UTSW 19 6856165 missense probably benign 0.13
R9441:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9442:Ccdc88b UTSW 19 6855845 missense probably damaging 1.00
R9748:Ccdc88b UTSW 19 6854093 missense probably damaging 1.00
R9766:Ccdc88b UTSW 19 6855728 missense probably damaging 1.00
X0021:Ccdc88b UTSW 19 6853831 missense probably benign
Z1176:Ccdc88b UTSW 19 6849740 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCTGAGAACACTTGGGTGAC -3'
(R):5'- CACCCTCACTGCAAGATGAG -3'

Sequencing Primer
(F):5'- ACCTTGTGATGTCAGAGTATGATGC -3'
(R):5'- CCCTCACTGCAAGATGAGGTGAG -3'
Posted On 2014-06-23