Incidental Mutation 'R1840:Kif1b'
ID205683
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Namekinesin family member 1B
SynonymsKif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission 039866-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1840 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location149176319-149307693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 149188132 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 138 (R138Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]
Predicted Effect probably damaging
Transcript: ENSMUST00000055647
AA Change: R1414Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: R1414Q

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060537
AA Change: R1460Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: R1460Q

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139123
AA Change: R138Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120076
Gene: ENSMUSG00000063077
AA Change: R138Q

DomainStartEndE-ValueType
Pfam:DUF3694 1 92 4.4e-23 PFAM
low complexity region 169 186 N/A INTRINSIC
low complexity region 204 232 N/A INTRINSIC
low complexity region 298 316 N/A INTRINSIC
PH 381 480 1.02e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150853
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik T C 2: 92,383,209 S36P probably benign Het
2510009E07Rik T A 16: 21,653,486 M85L probably benign Het
Aatk T G 11: 120,013,732 D206A probably damaging Het
Agap3 A G 5: 24,500,231 D719G probably damaging Het
Agrn G A 4: 156,167,415 R1797C probably damaging Het
Ascc3 T A 10: 50,690,161 M734K probably benign Het
Asph T A 4: 9,601,340 M136L possibly damaging Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atp2b1 A G 10: 99,022,929 H1158R probably benign Het
Atxn7l1 A G 12: 33,371,033 probably null Het
BC024139 G T 15: 76,120,642 S611R probably benign Het
Becn1 C T 11: 101,295,566 G105S probably damaging Het
Bud13 A G 9: 46,286,408 E70G probably damaging Het
Cacul1 A T 19: 60,534,250 L282* probably null Het
Ccar1 T A 10: 62,763,510 K614M probably damaging Het
Cd96 T C 16: 46,099,092 T189A probably benign Het
Cdh5 C A 8: 104,126,616 Y189* probably null Het
Chka A G 19: 3,886,460 N284S probably benign Het
Cntn6 A T 6: 104,774,480 I366F probably damaging Het
Csmd3 C T 15: 47,607,164 G3372E probably damaging Het
Cyp4f16 T C 17: 32,543,006 probably null Het
Dcaf6 A G 1: 165,399,748 V270A probably damaging Het
Ddx60 T A 8: 61,969,553 I608N probably damaging Het
Dnah9 A T 11: 65,834,198 C1849* probably null Het
Eci3 C A 13: 34,960,041 V34L probably benign Het
Epha1 C T 6: 42,363,588 R583H probably damaging Het
Erbin A T 13: 103,834,947 N720K probably benign Het
Eya1 T A 1: 14,229,504 R346* probably null Het
Fam189a1 C A 7: 64,759,195 V484L probably benign Het
Fhdc1 G A 3: 84,445,821 T699I possibly damaging Het
Flvcr2 T C 12: 85,803,221 V427A possibly damaging Het
Fzd9 T A 5: 135,249,571 T487S probably benign Het
Gas2l3 T C 10: 89,422,251 Y160C possibly damaging Het
Gm10264 T C 12: 88,329,411 V53A probably benign Het
Gm10269 T C 18: 20,682,809 K52R probably damaging Het
Gm16432 A G 1: 178,003,015 D30G possibly damaging Het
Gm8674 A T 13: 49,901,765 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Gramd4 T C 15: 86,130,192 probably null Het
Gtpbp4 A G 13: 8,979,464 L403P probably benign Het
H6pd A T 4: 149,982,050 D626E possibly damaging Het
Herc6 T A 6: 57,658,106 L769* probably null Het
Hes5 A G 4: 154,961,254 K58R probably damaging Het
Heyl A G 4: 123,241,390 I59V probably damaging Het
Hpca A G 4: 129,118,600 F48L probably damaging Het
Ice1 C T 13: 70,606,218 R583Q probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kansl1l T A 1: 66,778,032 I390F probably damaging Het
Kat5 C T 19: 5,609,238 V95M possibly damaging Het
Kcnh4 T A 11: 100,745,341 I827F possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lats1 T A 10: 7,710,939 L955* probably null Het
Ldlrad2 A C 4: 137,572,184 C110G possibly damaging Het
Lgi3 G A 14: 70,534,776 probably null Het
Lingo1 A G 9: 56,620,558 M249T probably benign Het
Lrig3 A T 10: 126,013,389 R993* probably null Het
Lsm14b T A 2: 180,026,728 I74N probably damaging Het
Lyplal1 T A 1: 186,100,217 I114F probably damaging Het
Mmp15 A G 8: 95,365,420 Y86C probably damaging Het
Myh2 A G 11: 67,186,487 E816G probably benign Het
Myo5c A G 9: 75,249,735 N151S probably damaging Het
Nckap1 T A 2: 80,502,250 E1082V possibly damaging Het
Nrg4 A C 9: 55,282,606 probably benign Het
Nrp2 T C 1: 62,738,339 L101P probably damaging Het
Olfr1180 T C 2: 88,412,067 D197G probably benign Het
Olfr126 A T 17: 37,850,748 D52V probably damaging Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr638 A G 7: 104,004,117 I281V probably benign Het
Olfr992 G A 2: 85,400,168 R122C probably benign Het
Parp14 T A 16: 35,863,449 E169V probably damaging Het
Pcolce2 G A 9: 95,670,117 R101H probably damaging Het
Pcolce2 A T 9: 95,670,203 N130Y probably benign Het
Plscr1 A T 9: 92,258,074 S5C unknown Het
Plxdc2 T C 2: 16,669,856 V338A probably benign Het
Psg23 T A 7: 18,610,438 N364I possibly damaging Het
Psmg4 A G 13: 34,178,056 E109G probably damaging Het
Ptk2 T C 15: 73,210,884 E908G probably damaging Het
Ptpn14 G A 1: 189,786,851 R26H probably damaging Het
Ranbp2 T A 10: 58,478,766 N1769K probably benign Het
Rbm14 C T 19: 4,801,795 probably benign Het
Rgs7 A T 1: 175,153,148 D103E probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rock2 T A 12: 16,928,989 D93E probably benign Het
Rps6ka6 A G X: 111,420,932 I246T possibly damaging Het
Rubcn T C 16: 32,826,172 M803V possibly damaging Het
Ryr3 T C 2: 112,750,820 Y2889C probably damaging Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Selplg T C 5: 113,819,844 T134A possibly damaging Het
Sez6 C A 11: 77,953,717 T122N possibly damaging Het
Slc9b1 T A 3: 135,357,468 D4E unknown Het
Smim18 A G 8: 33,742,348 M81T probably benign Het
Snap91 A T 9: 86,815,465 H281Q probably damaging Het
Sparc C A 11: 55,395,866 C302F probably damaging Het
Spg11 A G 2: 122,101,756 L535P probably damaging Het
Spsb1 G A 4: 149,906,631 T160I probably damaging Het
Stra6 A G 9: 58,140,530 N128S probably benign Het
Strc T C 2: 121,379,296 E182G probably damaging Het
Sult2a6 A G 7: 14,254,829 M2T probably benign Het
Sv2c T C 13: 95,981,844 N499S probably benign Het
Szt2 A T 4: 118,365,657 probably benign Het
Tbx20 A T 9: 24,725,676 S372T probably benign Het
Tcp11l2 T A 10: 84,604,599 S289T probably damaging Het
Tdrd1 A G 19: 56,842,312 E259G probably damaging Het
Thsd7a T A 6: 12,330,974 I1390L probably benign Het
Tln2 G A 9: 67,342,043 R921W probably damaging Het
Tmem126a C A 7: 90,452,884 G36* probably null Het
Tmem245 C T 4: 56,903,947 V606I probably benign Het
Trpm6 A G 19: 18,866,267 D1665G probably benign Het
Ubac2 T G 14: 121,994,262 V200G probably benign Het
Ubr5 G A 15: 37,980,917 A2372V possibly damaging Het
Ugcg C T 4: 59,219,517 P285S probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r118 T A 17: 55,610,406 K369* probably null Het
Xpnpep3 G T 15: 81,427,353 A87S probably benign Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zdhhc11 A G 13: 73,974,652 N169S probably damaging Het
Zfp62 T A 11: 49,216,388 D435E probably damaging Het
Zfyve16 T C 13: 92,511,525 D1007G possibly damaging Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149220602 missense probably damaging 1.00
IGL01943:Kif1b APN 4 149214905 critical splice donor site probably null
IGL02240:Kif1b APN 4 149246414 missense probably damaging 1.00
IGL02414:Kif1b APN 4 149199314 missense probably damaging 0.96
IGL02490:Kif1b APN 4 149204208 missense probably benign
IGL02501:Kif1b APN 4 149214976 missense probably damaging 1.00
IGL02833:Kif1b APN 4 149246364 missense probably damaging 1.00
IGL02852:Kif1b APN 4 149291328 missense probably damaging 1.00
IGL02900:Kif1b APN 4 149180809 missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149214981 missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149274939 missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149220792 critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149181927 missense probably damaging 1.00
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0129:Kif1b UTSW 4 149261201 missense probably benign
R0180:Kif1b UTSW 4 149213659 missense probably damaging 1.00
R0288:Kif1b UTSW 4 149199338 missense probably damaging 1.00
R0360:Kif1b UTSW 4 149262729 missense probably damaging 1.00
R0383:Kif1b UTSW 4 149202512 missense probably damaging 1.00
R0398:Kif1b UTSW 4 149204231 missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149181967 nonsense probably null
R0445:Kif1b UTSW 4 149188009 missense probably benign 0.01
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1681:Kif1b UTSW 4 149195501 critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149187722 missense probably damaging 0.99
R1874:Kif1b UTSW 4 149187632 missense probably benign
R1915:Kif1b UTSW 4 149267216 missense probably damaging 1.00
R2106:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149222296 missense probably benign 0.08
R2126:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149184309 missense probably damaging 0.99
R2255:Kif1b UTSW 4 149274997 missense probably damaging 1.00
R2392:Kif1b UTSW 4 149220620 missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149237648 missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149220541 critical splice donor site probably null
R3038:Kif1b UTSW 4 149213333 missense probably benign 0.02
R3616:Kif1b UTSW 4 149262283 splice site probably benign
R3935:Kif1b UTSW 4 149237160 missense probably benign 0.00
R4347:Kif1b UTSW 4 149247234 missense probably damaging 1.00
R4423:Kif1b UTSW 4 149214105 missense probably damaging 0.99
R4637:Kif1b UTSW 4 149199311 missense probably damaging 0.97
R4745:Kif1b UTSW 4 149237882 nonsense probably null
R4807:Kif1b UTSW 4 149247921 intron probably benign
R5618:Kif1b UTSW 4 149269889 missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149238482 missense probably damaging 0.96
R5683:Kif1b UTSW 4 149222261 missense probably damaging 1.00
R5696:Kif1b UTSW 4 149273849 splice site probably null
R6022:Kif1b UTSW 4 149198532 missense probably benign 0.01
R6048:Kif1b UTSW 4 149263629 missense probably damaging 1.00
R6137:Kif1b UTSW 4 149238426 missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149237532 missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149258048 missense probably damaging 1.00
R6250:Kif1b UTSW 4 149213643 missense probably benign 0.00
R6423:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6424:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6425:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6443:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6460:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6462:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6463:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6469:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6470:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6471:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6472:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6504:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6536:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6537:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6668:Kif1b UTSW 4 149213407 missense probably benign 0.09
R6698:Kif1b UTSW 4 149274956 missense probably damaging 0.99
R7065:Kif1b UTSW 4 149202525 missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149225157 missense probably damaging 1.00
R7342:Kif1b UTSW 4 149214090 missense possibly damaging 0.94
R7720:Kif1b UTSW 4 149182355 missense probably benign 0.01
X0009:Kif1b UTSW 4 149247264 missense probably damaging 1.00
X0062:Kif1b UTSW 4 149275005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGGAAGTCAAAGCGC -3'
(R):5'- TTTCACAAGGCCCTAGGTCTG -3'

Sequencing Primer
(F):5'- GATGCTGTCCTGCCTGAGTC -3'
(R):5'- GACTATGTCCCCCAGACTAGTATGG -3'
Posted On2014-06-23