Incidental Mutation 'R1840:Thsd7a'
ID 205692
Institutional Source Beutler Lab
Gene Symbol Thsd7a
Ensembl Gene ENSMUSG00000032625
Gene Name thrombospondin, type I, domain containing 7A
Synonyms LOC330267
MMRRC Submission 039866-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1840 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 12311607-12749252 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12330973 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1390 (I1390L)
Ref Sequence ENSEMBL: ENSMUSP00000113681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046121
AA Change: I1390L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: I1390L

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.2e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119581
AA Change: I1390L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: I1390L

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1082 9.09e-8 SMART
TSP1 1085 1150 5.82e-1 SMART
TSP1 1155 1207 4.24e-2 SMART
TSP1 1210 1271 1e0 SMART
TSP1 1276 1328 3.55e-10 SMART
TSP1 1329 1399 7.5e-2 SMART
TSP1 1404 1462 1.55e-1 SMART
transmembrane domain 1594 1616 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122369
SMART Domains Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

DomainStartEndE-ValueType
TSP1 43 100 6.24e-6 SMART
TSP1 178 228 7.31e-2 SMART
Blast:TSP1 232 302 4e-26 BLAST
TSP1 307 362 9.09e-8 SMART
TSP1 365 430 5.82e-1 SMART
TSP1 435 487 4.24e-2 SMART
TSP1 490 551 1e0 SMART
TSP1 556 608 3.55e-10 SMART
TSP1 609 679 7.5e-2 SMART
TSP1 684 742 1.55e-1 SMART
transmembrane domain 874 896 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172356
AA Change: I1390L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: I1390L

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.95e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,472,236 (GRCm39) M85L probably benign Het
Aatk T G 11: 119,904,558 (GRCm39) D206A probably damaging Het
Agap3 A G 5: 24,705,229 (GRCm39) D719G probably damaging Het
Agrn G A 4: 156,251,872 (GRCm39) R1797C probably damaging Het
Ascc3 T A 10: 50,566,257 (GRCm39) M734K probably benign Het
Asph T A 4: 9,601,340 (GRCm39) M136L possibly damaging Het
Atm A T 9: 53,367,830 (GRCm39) V2431E probably damaging Het
Atp2b1 A G 10: 98,858,791 (GRCm39) H1158R probably benign Het
Atxn7l1 A G 12: 33,421,032 (GRCm39) probably null Het
BC024139 G T 15: 76,004,842 (GRCm39) S611R probably benign Het
Becn1 C T 11: 101,186,392 (GRCm39) G105S probably damaging Het
Bud13 A G 9: 46,197,706 (GRCm39) E70G probably damaging Het
Cacul1 A T 19: 60,522,688 (GRCm39) L282* probably null Het
Catspere2 A G 1: 177,830,581 (GRCm39) D30G possibly damaging Het
Ccar1 T A 10: 62,599,289 (GRCm39) K614M probably damaging Het
Cd96 T C 16: 45,919,455 (GRCm39) T189A probably benign Het
Cdh5 C A 8: 104,853,248 (GRCm39) Y189* probably null Het
Chka A G 19: 3,936,460 (GRCm39) N284S probably benign Het
Cntn6 A T 6: 104,751,441 (GRCm39) I366F probably damaging Het
Csmd3 C T 15: 47,470,560 (GRCm39) G3372E probably damaging Het
Cyp4f16 T C 17: 32,761,980 (GRCm39) probably null Het
Dcaf6 A G 1: 165,227,317 (GRCm39) V270A probably damaging Het
Ddx60 T A 8: 62,422,587 (GRCm39) I608N probably damaging Het
Dnah9 A T 11: 65,725,024 (GRCm39) C1849* probably null Het
Eci3 C A 13: 35,144,024 (GRCm39) V34L probably benign Het
Eif1ad9 T C 12: 88,296,181 (GRCm39) V53A probably benign Het
Entrep2 C A 7: 64,408,943 (GRCm39) V484L probably benign Het
Epha1 C T 6: 42,340,522 (GRCm39) R583H probably damaging Het
Erbin A T 13: 103,971,455 (GRCm39) N720K probably benign Het
Eya1 T A 1: 14,299,728 (GRCm39) R346* probably null Het
Fhdc1 G A 3: 84,353,128 (GRCm39) T699I possibly damaging Het
Flvcr2 T C 12: 85,849,995 (GRCm39) V427A possibly damaging Het
Frey1 T C 2: 92,213,554 (GRCm39) S36P probably benign Het
Fzd9 T A 5: 135,278,425 (GRCm39) T487S probably benign Het
Gas2l3 T C 10: 89,258,113 (GRCm39) Y160C possibly damaging Het
Gm10269 T C 18: 20,815,866 (GRCm39) K52R probably damaging Het
Gm8674 A T 13: 50,055,801 (GRCm39) noncoding transcript Het
Gpr61 A G 3: 108,057,797 (GRCm39) V288A possibly damaging Het
Gramd4 T C 15: 86,014,393 (GRCm39) probably null Het
Gtpbp4 A G 13: 9,029,500 (GRCm39) L403P probably benign Het
H6pd A T 4: 150,066,507 (GRCm39) D626E possibly damaging Het
Herc6 T A 6: 57,635,091 (GRCm39) L769* probably null Het
Hes5 A G 4: 155,045,711 (GRCm39) K58R probably damaging Het
Heyl A G 4: 123,135,183 (GRCm39) I59V probably damaging Het
Hpca A G 4: 129,012,393 (GRCm39) F48L probably damaging Het
Ice1 C T 13: 70,754,337 (GRCm39) R583Q probably benign Het
Ints2 C T 11: 86,123,911 (GRCm39) G626R probably damaging Het
Kansl1l T A 1: 66,817,191 (GRCm39) I390F probably damaging Het
Kat5 C T 19: 5,659,266 (GRCm39) V95M possibly damaging Het
Kcnh4 T A 11: 100,636,167 (GRCm39) I827F possibly damaging Het
Kif1b C T 4: 149,272,589 (GRCm39) R138Q probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lats1 T A 10: 7,586,703 (GRCm39) L955* probably null Het
Ldlrad2 A C 4: 137,299,495 (GRCm39) C110G possibly damaging Het
Lgi3 G A 14: 70,772,216 (GRCm39) probably null Het
Lingo1 A G 9: 56,527,842 (GRCm39) M249T probably benign Het
Lrig3 A T 10: 125,849,258 (GRCm39) R993* probably null Het
Lsm14b T A 2: 179,668,521 (GRCm39) I74N probably damaging Het
Lyplal1 T A 1: 185,832,414 (GRCm39) I114F probably damaging Het
Mmp15 A G 8: 96,092,048 (GRCm39) Y86C probably damaging Het
Myh2 A G 11: 67,077,313 (GRCm39) E816G probably benign Het
Myo5c A G 9: 75,157,017 (GRCm39) N151S probably damaging Het
Nckap1 T A 2: 80,332,594 (GRCm39) E1082V possibly damaging Het
Nrg4 A C 9: 55,189,890 (GRCm39) probably benign Het
Nrp2 T C 1: 62,777,498 (GRCm39) L101P probably damaging Het
Or14j5 A T 17: 38,161,639 (GRCm39) D52V probably damaging Het
Or2at1 A T 7: 99,416,803 (GRCm39) T145S probably benign Het
Or4p19 T C 2: 88,242,411 (GRCm39) D197G probably benign Het
Or51q1c A G 7: 103,653,324 (GRCm39) I281V probably benign Het
Or5ak22 G A 2: 85,230,512 (GRCm39) R122C probably benign Het
Parp14 T A 16: 35,683,819 (GRCm39) E169V probably damaging Het
Pcolce2 A T 9: 95,552,256 (GRCm39) N130Y probably benign Het
Pcolce2 G A 9: 95,552,170 (GRCm39) R101H probably damaging Het
Plscr1 A T 9: 92,140,127 (GRCm39) S5C unknown Het
Plxdc2 T C 2: 16,674,667 (GRCm39) V338A probably benign Het
Psg23 T A 7: 18,344,363 (GRCm39) N364I possibly damaging Het
Psmg4 A G 13: 34,362,039 (GRCm39) E109G probably damaging Het
Ptk2 T C 15: 73,082,733 (GRCm39) E908G probably damaging Het
Ptpn14 G A 1: 189,519,048 (GRCm39) R26H probably damaging Het
Ranbp2 T A 10: 58,314,588 (GRCm39) N1769K probably benign Het
Rbm14 C T 19: 4,851,823 (GRCm39) probably benign Het
Rgs7 A T 1: 174,980,714 (GRCm39) D103E probably damaging Het
Rmnd5a G A 6: 71,375,439 (GRCm39) L80F probably benign Het
Rock2 T A 12: 16,978,990 (GRCm39) D93E probably benign Het
Rps6ka6 A G X: 110,330,629 (GRCm39) I246T possibly damaging Het
Rubcn T C 16: 32,646,542 (GRCm39) M803V possibly damaging Het
Ryr3 T C 2: 112,581,165 (GRCm39) Y2889C probably damaging Het
Sall2 T C 14: 52,551,182 (GRCm39) N671S probably damaging Het
Selplg T C 5: 113,957,905 (GRCm39) T134A possibly damaging Het
Sez6 C A 11: 77,844,543 (GRCm39) T122N possibly damaging Het
Slc9b1 T A 3: 135,063,229 (GRCm39) D4E unknown Het
Smim18 A G 8: 34,232,376 (GRCm39) M81T probably benign Het
Snap91 A T 9: 86,697,518 (GRCm39) H281Q probably damaging Het
Sparc C A 11: 55,286,692 (GRCm39) C302F probably damaging Het
Spg11 A G 2: 121,932,237 (GRCm39) L535P probably damaging Het
Spsb1 G A 4: 149,991,088 (GRCm39) T160I probably damaging Het
Stra6 A G 9: 58,047,813 (GRCm39) N128S probably benign Het
Strc T C 2: 121,209,777 (GRCm39) E182G probably damaging Het
Sult2a6 A G 7: 13,988,754 (GRCm39) M2T probably benign Het
Sv2c T C 13: 96,118,352 (GRCm39) N499S probably benign Het
Szt2 A T 4: 118,222,854 (GRCm39) probably benign Het
Tbx20 A T 9: 24,636,972 (GRCm39) S372T probably benign Het
Tcp11l2 T A 10: 84,440,463 (GRCm39) S289T probably damaging Het
Tdrd1 A G 19: 56,830,744 (GRCm39) E259G probably damaging Het
Tln2 G A 9: 67,249,325 (GRCm39) R921W probably damaging Het
Tmem126a C A 7: 90,102,092 (GRCm39) G36* probably null Het
Tmem245 C T 4: 56,903,947 (GRCm39) V606I probably benign Het
Trpm6 A G 19: 18,843,631 (GRCm39) D1665G probably benign Het
Ubac2 T G 14: 122,231,674 (GRCm39) V200G probably benign Het
Ubr5 G A 15: 37,981,161 (GRCm39) A2372V possibly damaging Het
Ugcg C T 4: 59,219,517 (GRCm39) P285S probably damaging Het
Vmn1r9 T C 6: 57,048,522 (GRCm39) V199A probably damaging Het
Vmn2r118 T A 17: 55,917,406 (GRCm39) K369* probably null Het
Xpnpep3 G T 15: 81,311,554 (GRCm39) A87S probably benign Het
Zc3h7a C T 16: 10,978,890 (GRCm39) R95H probably damaging Het
Zdhhc11 A G 13: 74,122,771 (GRCm39) N169S probably damaging Het
Zfp62 T A 11: 49,107,215 (GRCm39) D435E probably damaging Het
Zfyve16 T C 13: 92,648,033 (GRCm39) D1007G possibly damaging Het
Other mutations in Thsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Thsd7a APN 6 12,379,658 (GRCm39) splice site probably null
IGL00563:Thsd7a APN 6 12,379,658 (GRCm39) splice site probably null
IGL00753:Thsd7a APN 6 12,327,528 (GRCm39) missense probably damaging 1.00
IGL00835:Thsd7a APN 6 12,554,933 (GRCm39) missense probably damaging 1.00
IGL01486:Thsd7a APN 6 12,471,079 (GRCm39) missense probably damaging 1.00
IGL01730:Thsd7a APN 6 12,554,980 (GRCm39) missense probably benign 0.05
IGL01931:Thsd7a APN 6 12,504,098 (GRCm39) missense probably damaging 1.00
IGL01935:Thsd7a APN 6 12,317,418 (GRCm39) missense probably damaging 1.00
IGL01978:Thsd7a APN 6 12,331,005 (GRCm39) missense probably benign 0.01
IGL02233:Thsd7a APN 6 12,555,257 (GRCm39) missense probably benign 0.00
IGL02354:Thsd7a APN 6 12,348,192 (GRCm39) splice site probably benign
IGL02361:Thsd7a APN 6 12,348,192 (GRCm39) splice site probably benign
IGL02375:Thsd7a APN 6 12,343,264 (GRCm39) missense probably damaging 1.00
IGL02468:Thsd7a APN 6 12,318,170 (GRCm39) missense probably damaging 0.98
IGL02616:Thsd7a APN 6 12,408,984 (GRCm39) missense probably damaging 0.98
IGL02820:Thsd7a APN 6 12,321,071 (GRCm39) missense probably damaging 1.00
IGL02858:Thsd7a APN 6 12,500,994 (GRCm39) missense probably benign 0.16
IGL03074:Thsd7a APN 6 12,324,680 (GRCm39) missense probably damaging 0.99
IGL03234:Thsd7a APN 6 12,343,177 (GRCm39) missense probably damaging 1.00
IGL03244:Thsd7a APN 6 12,504,167 (GRCm39) splice site probably benign
IGL03337:Thsd7a APN 6 12,405,173 (GRCm39) missense probably damaging 1.00
G1patch:Thsd7a UTSW 6 12,555,630 (GRCm39) missense possibly damaging 0.87
PIT4354001:Thsd7a UTSW 6 12,331,926 (GRCm39) critical splice donor site probably null
R0095:Thsd7a UTSW 6 12,320,969 (GRCm39) missense probably damaging 0.99
R0127:Thsd7a UTSW 6 12,554,907 (GRCm39) missense probably benign 0.01
R0142:Thsd7a UTSW 6 12,418,334 (GRCm39) missense probably damaging 1.00
R0226:Thsd7a UTSW 6 12,321,899 (GRCm39) missense possibly damaging 0.94
R0242:Thsd7a UTSW 6 12,503,915 (GRCm39) missense probably benign 0.32
R0242:Thsd7a UTSW 6 12,503,915 (GRCm39) missense probably benign 0.32
R0359:Thsd7a UTSW 6 12,352,030 (GRCm39) missense probably damaging 1.00
R0365:Thsd7a UTSW 6 12,321,886 (GRCm39) critical splice donor site probably null
R0504:Thsd7a UTSW 6 12,379,593 (GRCm39) missense probably damaging 0.99
R0512:Thsd7a UTSW 6 12,379,604 (GRCm39) missense possibly damaging 0.67
R0540:Thsd7a UTSW 6 12,331,541 (GRCm39) splice site probably null
R0577:Thsd7a UTSW 6 12,321,047 (GRCm39) missense possibly damaging 0.50
R0607:Thsd7a UTSW 6 12,331,541 (GRCm39) splice site probably null
R0755:Thsd7a UTSW 6 12,555,368 (GRCm39) missense probably damaging 1.00
R0771:Thsd7a UTSW 6 12,327,576 (GRCm39) missense probably benign 0.09
R0780:Thsd7a UTSW 6 12,337,273 (GRCm39) missense probably damaging 1.00
R0870:Thsd7a UTSW 6 12,337,273 (GRCm39) missense probably damaging 1.00
R0871:Thsd7a UTSW 6 12,337,273 (GRCm39) missense probably damaging 1.00
R0872:Thsd7a UTSW 6 12,337,273 (GRCm39) missense probably damaging 1.00
R0873:Thsd7a UTSW 6 12,337,273 (GRCm39) missense probably damaging 1.00
R1102:Thsd7a UTSW 6 12,555,701 (GRCm39) missense possibly damaging 0.58
R1144:Thsd7a UTSW 6 12,471,026 (GRCm39) splice site probably benign
R1265:Thsd7a UTSW 6 12,317,418 (GRCm39) missense probably damaging 0.99
R1276:Thsd7a UTSW 6 12,418,369 (GRCm39) missense probably damaging 1.00
R1381:Thsd7a UTSW 6 12,555,438 (GRCm39) missense probably damaging 1.00
R1473:Thsd7a UTSW 6 12,338,621 (GRCm39) missense probably benign 0.08
R1519:Thsd7a UTSW 6 12,471,174 (GRCm39) missense probably benign 0.01
R1633:Thsd7a UTSW 6 12,471,103 (GRCm39) nonsense probably null
R1659:Thsd7a UTSW 6 12,504,063 (GRCm39) missense possibly damaging 0.73
R1769:Thsd7a UTSW 6 12,555,714 (GRCm39) nonsense probably null
R1824:Thsd7a UTSW 6 12,409,041 (GRCm39) splice site probably null
R1845:Thsd7a UTSW 6 12,321,040 (GRCm39) missense probably damaging 1.00
R1874:Thsd7a UTSW 6 12,555,434 (GRCm39) missense possibly damaging 0.76
R2023:Thsd7a UTSW 6 12,327,535 (GRCm39) missense probably benign 0.16
R2039:Thsd7a UTSW 6 12,408,922 (GRCm39) missense possibly damaging 0.77
R2058:Thsd7a UTSW 6 12,318,105 (GRCm39) splice site probably benign
R2138:Thsd7a UTSW 6 12,471,072 (GRCm39) nonsense probably null
R2155:Thsd7a UTSW 6 12,379,632 (GRCm39) missense probably damaging 1.00
R2175:Thsd7a UTSW 6 12,331,943 (GRCm39) missense possibly damaging 0.95
R2216:Thsd7a UTSW 6 12,337,267 (GRCm39) missense possibly damaging 0.95
R2318:Thsd7a UTSW 6 12,405,146 (GRCm39) missense probably damaging 1.00
R2375:Thsd7a UTSW 6 12,337,361 (GRCm39) missense probably damaging 1.00
R3857:Thsd7a UTSW 6 12,555,225 (GRCm39) missense probably benign 0.15
R3858:Thsd7a UTSW 6 12,555,225 (GRCm39) missense probably benign 0.15
R3890:Thsd7a UTSW 6 12,418,336 (GRCm39) missense probably benign 0.09
R3910:Thsd7a UTSW 6 12,331,548 (GRCm39) missense probably damaging 0.96
R3933:Thsd7a UTSW 6 12,555,225 (GRCm39) missense probably benign 0.15
R4369:Thsd7a UTSW 6 12,468,907 (GRCm39) missense probably damaging 1.00
R4447:Thsd7a UTSW 6 12,324,634 (GRCm39) missense probably damaging 0.98
R4664:Thsd7a UTSW 6 12,504,012 (GRCm39) missense possibly damaging 0.90
R4664:Thsd7a UTSW 6 12,337,313 (GRCm39) missense possibly damaging 0.79
R4665:Thsd7a UTSW 6 12,504,012 (GRCm39) missense possibly damaging 0.90
R4665:Thsd7a UTSW 6 12,337,313 (GRCm39) missense possibly damaging 0.79
R4666:Thsd7a UTSW 6 12,504,012 (GRCm39) missense possibly damaging 0.90
R4666:Thsd7a UTSW 6 12,337,313 (GRCm39) missense possibly damaging 0.79
R4668:Thsd7a UTSW 6 12,408,967 (GRCm39) missense probably damaging 0.98
R4886:Thsd7a UTSW 6 12,327,659 (GRCm39) nonsense probably null
R4918:Thsd7a UTSW 6 12,327,558 (GRCm39) missense probably damaging 1.00
R4938:Thsd7a UTSW 6 12,330,991 (GRCm39) missense probably benign 0.09
R5064:Thsd7a UTSW 6 12,330,951 (GRCm39) missense possibly damaging 0.66
R5153:Thsd7a UTSW 6 12,338,654 (GRCm39) missense probably benign 0.00
R5177:Thsd7a UTSW 6 12,379,582 (GRCm39) nonsense probably null
R5242:Thsd7a UTSW 6 12,327,582 (GRCm39) missense probably damaging 1.00
R5267:Thsd7a UTSW 6 12,379,601 (GRCm39) missense probably damaging 1.00
R5442:Thsd7a UTSW 6 12,748,799 (GRCm39) missense probably benign 0.00
R5506:Thsd7a UTSW 6 12,332,016 (GRCm39) missense possibly damaging 0.85
R5525:Thsd7a UTSW 6 12,332,006 (GRCm39) missense possibly damaging 0.52
R5544:Thsd7a UTSW 6 12,379,470 (GRCm39) missense possibly damaging 0.94
R5651:Thsd7a UTSW 6 12,343,212 (GRCm39) missense probably damaging 1.00
R5716:Thsd7a UTSW 6 12,343,147 (GRCm39) missense probably benign 0.00
R5848:Thsd7a UTSW 6 12,503,922 (GRCm39) missense probably damaging 1.00
R5958:Thsd7a UTSW 6 12,337,261 (GRCm39) missense probably benign 0.02
R6012:Thsd7a UTSW 6 12,379,388 (GRCm39) splice site probably null
R6139:Thsd7a UTSW 6 12,379,572 (GRCm39) missense possibly damaging 0.93
R6243:Thsd7a UTSW 6 12,327,601 (GRCm39) missense probably damaging 1.00
R6257:Thsd7a UTSW 6 12,408,987 (GRCm39) nonsense probably null
R6273:Thsd7a UTSW 6 12,408,835 (GRCm39) missense probably damaging 0.99
R6300:Thsd7a UTSW 6 12,471,103 (GRCm39) nonsense probably null
R6314:Thsd7a UTSW 6 12,554,996 (GRCm39) missense possibly damaging 0.87
R6392:Thsd7a UTSW 6 12,468,928 (GRCm39) missense probably damaging 0.99
R6418:Thsd7a UTSW 6 12,555,081 (GRCm39) nonsense probably null
R6515:Thsd7a UTSW 6 12,501,085 (GRCm39) missense possibly damaging 0.47
R6725:Thsd7a UTSW 6 12,555,630 (GRCm39) missense possibly damaging 0.87
R6742:Thsd7a UTSW 6 12,408,815 (GRCm39) missense probably damaging 1.00
R6776:Thsd7a UTSW 6 12,555,636 (GRCm39) missense possibly damaging 0.53
R6838:Thsd7a UTSW 6 12,504,074 (GRCm39) missense probably damaging 0.99
R7104:Thsd7a UTSW 6 12,379,429 (GRCm39) missense
R7170:Thsd7a UTSW 6 12,352,090 (GRCm39) missense
R7349:Thsd7a UTSW 6 12,352,067 (GRCm39) missense
R7460:Thsd7a UTSW 6 12,554,933 (GRCm39) missense
R7467:Thsd7a UTSW 6 12,331,584 (GRCm39) missense
R7666:Thsd7a UTSW 6 12,379,437 (GRCm39) missense
R7869:Thsd7a UTSW 6 12,471,123 (GRCm39) nonsense probably null
R8032:Thsd7a UTSW 6 12,555,287 (GRCm39) missense
R8165:Thsd7a UTSW 6 12,468,962 (GRCm39) missense
R8167:Thsd7a UTSW 6 12,317,400 (GRCm39) nonsense probably null
R8245:Thsd7a UTSW 6 12,379,592 (GRCm39) missense
R8310:Thsd7a UTSW 6 12,396,612 (GRCm39) missense
R8312:Thsd7a UTSW 6 12,471,181 (GRCm39) missense
R8331:Thsd7a UTSW 6 12,471,157 (GRCm39) missense
R8755:Thsd7a UTSW 6 12,408,851 (GRCm39) nonsense probably null
R8843:Thsd7a UTSW 6 12,501,136 (GRCm39) missense
R8867:Thsd7a UTSW 6 12,338,686 (GRCm39) missense
R8952:Thsd7a UTSW 6 12,468,992 (GRCm39) missense probably damaging 0.98
R9036:Thsd7a UTSW 6 12,418,249 (GRCm39) missense
R9299:Thsd7a UTSW 6 12,504,131 (GRCm39) missense
R9366:Thsd7a UTSW 6 12,555,480 (GRCm39) missense
R9489:Thsd7a UTSW 6 12,352,022 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GGACTATACGTGTAACCTCTTCTTAAC -3'
(R):5'- ACTGCAAACCATGAGCTCTC -3'

Sequencing Primer
(F):5'- CACTGTAAACTCTGACAGTGTGAGC -3'
(R):5'- TGCAAACCATGAGCTCTCTAATG -3'
Posted On 2014-06-23