Incidental Mutation 'R1840:Epha1'
ID205693
Institutional Source Beutler Lab
Gene Symbol Epha1
Ensembl Gene ENSMUSG00000029859
Gene NameEph receptor A1
SynonymsEph, 5730453L17Rik, Esk
MMRRC Submission 039866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R1840 (G1)
Quality Score92
Status Not validated
Chromosome6
Chromosomal Location42358487-42373268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42363588 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 583 (R583H)
Ref Sequence ENSEMBL: ENSMUSP00000073099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073387] [ENSMUST00000164375] [ENSMUST00000204357]
PDB Structure
The solution structure of the second fibronectin type III domain of mouse Ephrin type-A receptor 1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000073387
AA Change: R583H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073099
Gene: ENSMUSG00000029859
AA Change: R583H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 3.23e-103 SMART
FN3 334 430 8.43e-9 SMART
FN3 448 526 1.59e-4 SMART
Pfam:EphA2_TM 549 622 3.4e-13 PFAM
TyrKc 625 881 2.57e-126 SMART
SAM 911 977 4.13e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164375
SMART Domains Protein: ENSMUSP00000126622
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204238
Predicted Effect probably damaging
Transcript: ENSMUST00000204357
AA Change: R620H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144763
Gene: ENSMUSG00000029859
AA Change: R620H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 1.1e-105 SMART
FN3 334 430 4.2e-11 SMART
low complexity region 459 473 N/A INTRINSIC
FN3 483 563 2.4e-8 SMART
Pfam:EphA2_TM 586 659 7.6e-11 PFAM
STYKc 662 849 1.1e-65 SMART
SAM 879 945 2.5e-21 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a null allele exhibit a kinked tail while 18% of mice exhibit vagina atresia with hydrometrocolops and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik T C 2: 92,383,209 S36P probably benign Het
2510009E07Rik T A 16: 21,653,486 M85L probably benign Het
Aatk T G 11: 120,013,732 D206A probably damaging Het
Agap3 A G 5: 24,500,231 D719G probably damaging Het
Agrn G A 4: 156,167,415 R1797C probably damaging Het
Ascc3 T A 10: 50,690,161 M734K probably benign Het
Asph T A 4: 9,601,340 M136L possibly damaging Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atp2b1 A G 10: 99,022,929 H1158R probably benign Het
Atxn7l1 A G 12: 33,371,033 probably null Het
BC024139 G T 15: 76,120,642 S611R probably benign Het
Becn1 C T 11: 101,295,566 G105S probably damaging Het
Bud13 A G 9: 46,286,408 E70G probably damaging Het
Cacul1 A T 19: 60,534,250 L282* probably null Het
Ccar1 T A 10: 62,763,510 K614M probably damaging Het
Cd96 T C 16: 46,099,092 T189A probably benign Het
Cdh5 C A 8: 104,126,616 Y189* probably null Het
Chka A G 19: 3,886,460 N284S probably benign Het
Cntn6 A T 6: 104,774,480 I366F probably damaging Het
Csmd3 C T 15: 47,607,164 G3372E probably damaging Het
Cyp4f16 T C 17: 32,543,006 probably null Het
Dcaf6 A G 1: 165,399,748 V270A probably damaging Het
Ddx60 T A 8: 61,969,553 I608N probably damaging Het
Dnah9 A T 11: 65,834,198 C1849* probably null Het
Eci3 C A 13: 34,960,041 V34L probably benign Het
Erbin A T 13: 103,834,947 N720K probably benign Het
Eya1 T A 1: 14,229,504 R346* probably null Het
Fam189a1 C A 7: 64,759,195 V484L probably benign Het
Fhdc1 G A 3: 84,445,821 T699I possibly damaging Het
Flvcr2 T C 12: 85,803,221 V427A possibly damaging Het
Fzd9 T A 5: 135,249,571 T487S probably benign Het
Gas2l3 T C 10: 89,422,251 Y160C possibly damaging Het
Gm10264 T C 12: 88,329,411 V53A probably benign Het
Gm10269 T C 18: 20,682,809 K52R probably damaging Het
Gm16432 A G 1: 178,003,015 D30G possibly damaging Het
Gm8674 A T 13: 49,901,765 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Gramd4 T C 15: 86,130,192 probably null Het
Gtpbp4 A G 13: 8,979,464 L403P probably benign Het
H6pd A T 4: 149,982,050 D626E possibly damaging Het
Herc6 T A 6: 57,658,106 L769* probably null Het
Hes5 A G 4: 154,961,254 K58R probably damaging Het
Heyl A G 4: 123,241,390 I59V probably damaging Het
Hpca A G 4: 129,118,600 F48L probably damaging Het
Ice1 C T 13: 70,606,218 R583Q probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kansl1l T A 1: 66,778,032 I390F probably damaging Het
Kat5 C T 19: 5,609,238 V95M possibly damaging Het
Kcnh4 T A 11: 100,745,341 I827F possibly damaging Het
Kif1b C T 4: 149,188,132 R138Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lats1 T A 10: 7,710,939 L955* probably null Het
Ldlrad2 A C 4: 137,572,184 C110G possibly damaging Het
Lgi3 G A 14: 70,534,776 probably null Het
Lingo1 A G 9: 56,620,558 M249T probably benign Het
Lrig3 A T 10: 126,013,389 R993* probably null Het
Lsm14b T A 2: 180,026,728 I74N probably damaging Het
Lyplal1 T A 1: 186,100,217 I114F probably damaging Het
Mmp15 A G 8: 95,365,420 Y86C probably damaging Het
Myh2 A G 11: 67,186,487 E816G probably benign Het
Myo5c A G 9: 75,249,735 N151S probably damaging Het
Nckap1 T A 2: 80,502,250 E1082V possibly damaging Het
Nrg4 A C 9: 55,282,606 probably benign Het
Nrp2 T C 1: 62,738,339 L101P probably damaging Het
Olfr1180 T C 2: 88,412,067 D197G probably benign Het
Olfr126 A T 17: 37,850,748 D52V probably damaging Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr638 A G 7: 104,004,117 I281V probably benign Het
Olfr992 G A 2: 85,400,168 R122C probably benign Het
Parp14 T A 16: 35,863,449 E169V probably damaging Het
Pcolce2 G A 9: 95,670,117 R101H probably damaging Het
Pcolce2 A T 9: 95,670,203 N130Y probably benign Het
Plscr1 A T 9: 92,258,074 S5C unknown Het
Plxdc2 T C 2: 16,669,856 V338A probably benign Het
Psg23 T A 7: 18,610,438 N364I possibly damaging Het
Psmg4 A G 13: 34,178,056 E109G probably damaging Het
Ptk2 T C 15: 73,210,884 E908G probably damaging Het
Ptpn14 G A 1: 189,786,851 R26H probably damaging Het
Ranbp2 T A 10: 58,478,766 N1769K probably benign Het
Rbm14 C T 19: 4,801,795 probably benign Het
Rgs7 A T 1: 175,153,148 D103E probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rock2 T A 12: 16,928,989 D93E probably benign Het
Rps6ka6 A G X: 111,420,932 I246T possibly damaging Het
Rubcn T C 16: 32,826,172 M803V possibly damaging Het
Ryr3 T C 2: 112,750,820 Y2889C probably damaging Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Selplg T C 5: 113,819,844 T134A possibly damaging Het
Sez6 C A 11: 77,953,717 T122N possibly damaging Het
Slc9b1 T A 3: 135,357,468 D4E unknown Het
Smim18 A G 8: 33,742,348 M81T probably benign Het
Snap91 A T 9: 86,815,465 H281Q probably damaging Het
Sparc C A 11: 55,395,866 C302F probably damaging Het
Spg11 A G 2: 122,101,756 L535P probably damaging Het
Spsb1 G A 4: 149,906,631 T160I probably damaging Het
Stra6 A G 9: 58,140,530 N128S probably benign Het
Strc T C 2: 121,379,296 E182G probably damaging Het
Sult2a6 A G 7: 14,254,829 M2T probably benign Het
Sv2c T C 13: 95,981,844 N499S probably benign Het
Szt2 A T 4: 118,365,657 probably benign Het
Tbx20 A T 9: 24,725,676 S372T probably benign Het
Tcp11l2 T A 10: 84,604,599 S289T probably damaging Het
Tdrd1 A G 19: 56,842,312 E259G probably damaging Het
Thsd7a T A 6: 12,330,974 I1390L probably benign Het
Tln2 G A 9: 67,342,043 R921W probably damaging Het
Tmem126a C A 7: 90,452,884 G36* probably null Het
Tmem245 C T 4: 56,903,947 V606I probably benign Het
Trpm6 A G 19: 18,866,267 D1665G probably benign Het
Ubac2 T G 14: 121,994,262 V200G probably benign Het
Ubr5 G A 15: 37,980,917 A2372V possibly damaging Het
Ugcg C T 4: 59,219,517 P285S probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r118 T A 17: 55,610,406 K369* probably null Het
Xpnpep3 G T 15: 81,427,353 A87S probably benign Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zdhhc11 A G 13: 73,974,652 N169S probably damaging Het
Zfp62 T A 11: 49,216,388 D435E probably damaging Het
Zfyve16 T C 13: 92,511,525 D1007G possibly damaging Het
Other mutations in Epha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Epha1 APN 6 42360551 missense probably damaging 1.00
IGL02388:Epha1 APN 6 42365016 missense probably damaging 1.00
IGL02614:Epha1 APN 6 42360557 missense probably benign 0.02
IGL03019:Epha1 APN 6 42362752 missense probably damaging 1.00
buddy UTSW 6 42361451 missense probably damaging 1.00
R0369:Epha1 UTSW 6 42365473 missense probably damaging 1.00
R0894:Epha1 UTSW 6 42363822 missense probably benign 0.45
R1353:Epha1 UTSW 6 42361837 missense probably damaging 0.99
R1451:Epha1 UTSW 6 42361451 missense probably damaging 1.00
R2064:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2065:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2067:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2087:Epha1 UTSW 6 42363568 missense probably benign 0.01
R3691:Epha1 UTSW 6 42361130 missense probably damaging 1.00
R3952:Epha1 UTSW 6 42364285 missense probably damaging 0.99
R4111:Epha1 UTSW 6 42358838 missense possibly damaging 0.88
R4280:Epha1 UTSW 6 42365052 missense probably damaging 1.00
R4369:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4371:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4491:Epha1 UTSW 6 42360666 missense probably damaging 1.00
R4743:Epha1 UTSW 6 42372221 missense probably benign 0.00
R4838:Epha1 UTSW 6 42363816 missense probably benign 0.04
R4847:Epha1 UTSW 6 42361914 missense possibly damaging 0.88
R4857:Epha1 UTSW 6 42361482 missense probably benign 0.00
R4884:Epha1 UTSW 6 42360734 missense probably damaging 0.99
R4929:Epha1 UTSW 6 42364599 missense probably benign 0.05
R5239:Epha1 UTSW 6 42365010 missense possibly damaging 0.87
R5416:Epha1 UTSW 6 42365871 missense probably damaging 1.00
R5595:Epha1 UTSW 6 42364634 missense possibly damaging 0.78
R5838:Epha1 UTSW 6 42361646 missense probably damaging 1.00
R6395:Epha1 UTSW 6 42366172 missense probably damaging 1.00
R6594:Epha1 UTSW 6 42364691 missense probably benign
R6639:Epha1 UTSW 6 42365935 nonsense probably null
R7092:Epha1 UTSW 6 42364245 missense probably benign 0.36
R7569:Epha1 UTSW 6 42365422 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GGTGGCAAAACACAAGATCCTTAG -3'
(R):5'- AAGGTGCTGGCTCTGTCTTC -3'

Sequencing Primer
(F):5'- CAAGATCCTTAGGGACAGTATACTG -3'
(R):5'- CATCTGGGATTCCTTTGCCTTGTTAG -3'
Posted On2014-06-23