Mutagenetix > Incidental Mutation

Incidental Mutation 'R1840:Cntn6'

205697

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

039866-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R1840 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104774480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 366 (I366F)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably damaging
Transcript: ENSMUST00000089215
AA Change: I366F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: I366F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161070
AA Change: I294F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: I294F

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162872
AA Change: I366F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: I366F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 95.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029I15Rik	T	C	2: 92,383,209	S36P	probably benign	Het
2510009E07Rik	T	A	16: 21,653,486	M85L	probably benign	Het
Aatk	T	G	11: 120,013,732	D206A	probably damaging	Het
Agap3	A	G	5: 24,500,231	D719G	probably damaging	Het
Agrn	G	A	4: 156,167,415	R1797C	probably damaging	Het
Ascc3	T	A	10: 50,690,161	M734K	probably benign	Het
Asph	T	A	4: 9,601,340	M136L	possibly damaging	Het
Atm	A	T	9: 53,456,530	V2431E	probably damaging	Het
Atp2b1	A	G	10: 99,022,929	H1158R	probably benign	Het
Atxn7l1	A	G	12: 33,371,033		probably null	Het
BC024139	G	T	15: 76,120,642	S611R	probably benign	Het
Becn1	C	T	11: 101,295,566	G105S	probably damaging	Het
Bud13	A	G	9: 46,286,408	E70G	probably damaging	Het
Cacul1	A	T	19: 60,534,250	L282*	probably null	Het
Ccar1	T	A	10: 62,763,510	K614M	probably damaging	Het
Cd96	T	C	16: 46,099,092	T189A	probably benign	Het
Cdh5	C	A	8: 104,126,616	Y189*	probably null	Het
Chka	A	G	19: 3,886,460	N284S	probably benign	Het
Csmd3	C	T	15: 47,607,164	G3372E	probably damaging	Het
Cyp4f16	T	C	17: 32,543,006		probably null	Het
Dcaf6	A	G	1: 165,399,748	V270A	probably damaging	Het
Ddx60	T	A	8: 61,969,553	I608N	probably damaging	Het
Dnah9	A	T	11: 65,834,198	C1849*	probably null	Het
Eci3	C	A	13: 34,960,041	V34L	probably benign	Het
Epha1	C	T	6: 42,363,588	R583H	probably damaging	Het
Erbin	A	T	13: 103,834,947	N720K	probably benign	Het
Eya1	T	A	1: 14,229,504	R346*	probably null	Het
Fam189a1	C	A	7: 64,759,195	V484L	probably benign	Het
Fhdc1	G	A	3: 84,445,821	T699I	possibly damaging	Het
Flvcr2	T	C	12: 85,803,221	V427A	possibly damaging	Het
Fzd9	T	A	5: 135,249,571	T487S	probably benign	Het
Gas2l3	T	C	10: 89,422,251	Y160C	possibly damaging	Het
Gm10264	T	C	12: 88,329,411	V53A	probably benign	Het
Gm10269	T	C	18: 20,682,809	K52R	probably damaging	Het
Gm16432	A	G	1: 178,003,015	D30G	possibly damaging	Het
Gm8674	A	T	13: 49,901,765		noncoding transcript	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Gramd4	T	C	15: 86,130,192		probably null	Het
Gtpbp4	A	G	13: 8,979,464	L403P	probably benign	Het
H6pd	A	T	4: 149,982,050	D626E	possibly damaging	Het
Herc6	T	A	6: 57,658,106	L769*	probably null	Het
Hes5	A	G	4: 154,961,254	K58R	probably damaging	Het
Heyl	A	G	4: 123,241,390	I59V	probably damaging	Het
Hpca	A	G	4: 129,118,600	F48L	probably damaging	Het
Ice1	C	T	13: 70,606,218	R583Q	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kansl1l	T	A	1: 66,778,032	I390F	probably damaging	Het
Kat5	C	T	19: 5,609,238	V95M	possibly damaging	Het
Kcnh4	T	A	11: 100,745,341	I827F	possibly damaging	Het
Kif1b	C	T	4: 149,188,132	R138Q	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lats1	T	A	10: 7,710,939	L955*	probably null	Het
Ldlrad2	A	C	4: 137,572,184	C110G	possibly damaging	Het
Lgi3	G	A	14: 70,534,776		probably null	Het
Lingo1	A	G	9: 56,620,558	M249T	probably benign	Het
Lrig3	A	T	10: 126,013,389	R993*	probably null	Het
Lsm14b	T	A	2: 180,026,728	I74N	probably damaging	Het
Lyplal1	T	A	1: 186,100,217	I114F	probably damaging	Het
Mmp15	A	G	8: 95,365,420	Y86C	probably damaging	Het
Myh2	A	G	11: 67,186,487	E816G	probably benign	Het
Myo5c	A	G	9: 75,249,735	N151S	probably damaging	Het
Nckap1	T	A	2: 80,502,250	E1082V	possibly damaging	Het
Nrg4	A	C	9: 55,282,606		probably benign	Het
Nrp2	T	C	1: 62,738,339	L101P	probably damaging	Het
Olfr1180	T	C	2: 88,412,067	D197G	probably benign	Het
Olfr126	A	T	17: 37,850,748	D52V	probably damaging	Het
Olfr521	A	T	7: 99,767,596	T145S	probably benign	Het
Olfr638	A	G	7: 104,004,117	I281V	probably benign	Het
Olfr992	G	A	2: 85,400,168	R122C	probably benign	Het
Parp14	T	A	16: 35,863,449	E169V	probably damaging	Het
Pcolce2	G	A	9: 95,670,117	R101H	probably damaging	Het
Pcolce2	A	T	9: 95,670,203	N130Y	probably benign	Het
Plscr1	A	T	9: 92,258,074	S5C	unknown	Het
Plxdc2	T	C	2: 16,669,856	V338A	probably benign	Het
Psg23	T	A	7: 18,610,438	N364I	possibly damaging	Het
Psmg4	A	G	13: 34,178,056	E109G	probably damaging	Het
Ptk2	T	C	15: 73,210,884	E908G	probably damaging	Het
Ptpn14	G	A	1: 189,786,851	R26H	probably damaging	Het
Ranbp2	T	A	10: 58,478,766	N1769K	probably benign	Het
Rbm14	C	T	19: 4,801,795		probably benign	Het
Rgs7	A	T	1: 175,153,148	D103E	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Rock2	T	A	12: 16,928,989	D93E	probably benign	Het
Rps6ka6	A	G	X: 111,420,932	I246T	possibly damaging	Het
Rubcn	T	C	16: 32,826,172	M803V	possibly damaging	Het
Ryr3	T	C	2: 112,750,820	Y2889C	probably damaging	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Selplg	T	C	5: 113,819,844	T134A	possibly damaging	Het
Sez6	C	A	11: 77,953,717	T122N	possibly damaging	Het
Slc9b1	T	A	3: 135,357,468	D4E	unknown	Het
Smim18	A	G	8: 33,742,348	M81T	probably benign	Het
Snap91	A	T	9: 86,815,465	H281Q	probably damaging	Het
Sparc	C	A	11: 55,395,866	C302F	probably damaging	Het
Spg11	A	G	2: 122,101,756	L535P	probably damaging	Het
Spsb1	G	A	4: 149,906,631	T160I	probably damaging	Het
Stra6	A	G	9: 58,140,530	N128S	probably benign	Het
Strc	T	C	2: 121,379,296	E182G	probably damaging	Het
Sult2a6	A	G	7: 14,254,829	M2T	probably benign	Het
Sv2c	T	C	13: 95,981,844	N499S	probably benign	Het
Szt2	A	T	4: 118,365,657		probably benign	Het
Tbx20	A	T	9: 24,725,676	S372T	probably benign	Het
Tcp11l2	T	A	10: 84,604,599	S289T	probably damaging	Het
Tdrd1	A	G	19: 56,842,312	E259G	probably damaging	Het
Thsd7a	T	A	6: 12,330,974	I1390L	probably benign	Het
Tln2	G	A	9: 67,342,043	R921W	probably damaging	Het
Tmem126a	C	A	7: 90,452,884	G36*	probably null	Het
Tmem245	C	T	4: 56,903,947	V606I	probably benign	Het
Trpm6	A	G	19: 18,866,267	D1665G	probably benign	Het
Ubac2	T	G	14: 121,994,262	V200G	probably benign	Het
Ubr5	G	A	15: 37,980,917	A2372V	possibly damaging	Het
Ugcg	C	T	4: 59,219,517	P285S	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r118	T	A	17: 55,610,406	K369*	probably null	Het
Xpnpep3	G	T	15: 81,427,353	A87S	probably benign	Het
Zc3h7a	C	T	16: 11,161,026	R95H	probably damaging	Het
Zdhhc11	A	G	13: 73,974,652	N169S	probably damaging	Het
Zfp62	T	A	11: 49,216,388	D435E	probably damaging	Het
Zfyve16	T	C	13: 92,511,525	D1007G	possibly damaging	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTAACATCGATACTTCTGGCC -3'
(R):5'- CAGGTTCAGATCTTGTAAAAGTGAC -3'

Sequencing Primer
(F):5'- CGATACTTCTGGCCAAAAACTTG -3'
(R):5'- TTTTCTGCAGCACACTGG -3'

Posted On

2014-06-23