Incidental Mutation 'R1840:Ddx60'
ID205705
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission 039866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R1840 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61969553 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 608 (I608N)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
Predicted Effect probably damaging
Transcript: ENSMUST00000070631
AA Change: I607N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: I607N

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000093485
AA Change: I608N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: I608N

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik T C 2: 92,383,209 S36P probably benign Het
2510009E07Rik T A 16: 21,653,486 M85L probably benign Het
Aatk T G 11: 120,013,732 D206A probably damaging Het
Agap3 A G 5: 24,500,231 D719G probably damaging Het
Agrn G A 4: 156,167,415 R1797C probably damaging Het
Ascc3 T A 10: 50,690,161 M734K probably benign Het
Asph T A 4: 9,601,340 M136L possibly damaging Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atp2b1 A G 10: 99,022,929 H1158R probably benign Het
Atxn7l1 A G 12: 33,371,033 probably null Het
BC024139 G T 15: 76,120,642 S611R probably benign Het
Becn1 C T 11: 101,295,566 G105S probably damaging Het
Bud13 A G 9: 46,286,408 E70G probably damaging Het
Cacul1 A T 19: 60,534,250 L282* probably null Het
Ccar1 T A 10: 62,763,510 K614M probably damaging Het
Cd96 T C 16: 46,099,092 T189A probably benign Het
Cdh5 C A 8: 104,126,616 Y189* probably null Het
Chka A G 19: 3,886,460 N284S probably benign Het
Cntn6 A T 6: 104,774,480 I366F probably damaging Het
Csmd3 C T 15: 47,607,164 G3372E probably damaging Het
Cyp4f16 T C 17: 32,543,006 probably null Het
Dcaf6 A G 1: 165,399,748 V270A probably damaging Het
Dnah9 A T 11: 65,834,198 C1849* probably null Het
Eci3 C A 13: 34,960,041 V34L probably benign Het
Epha1 C T 6: 42,363,588 R583H probably damaging Het
Erbin A T 13: 103,834,947 N720K probably benign Het
Eya1 T A 1: 14,229,504 R346* probably null Het
Fam189a1 C A 7: 64,759,195 V484L probably benign Het
Fhdc1 G A 3: 84,445,821 T699I possibly damaging Het
Flvcr2 T C 12: 85,803,221 V427A possibly damaging Het
Fzd9 T A 5: 135,249,571 T487S probably benign Het
Gas2l3 T C 10: 89,422,251 Y160C possibly damaging Het
Gm10264 T C 12: 88,329,411 V53A probably benign Het
Gm10269 T C 18: 20,682,809 K52R probably damaging Het
Gm16432 A G 1: 178,003,015 D30G possibly damaging Het
Gm8674 A T 13: 49,901,765 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Gramd4 T C 15: 86,130,192 probably null Het
Gtpbp4 A G 13: 8,979,464 L403P probably benign Het
H6pd A T 4: 149,982,050 D626E possibly damaging Het
Herc6 T A 6: 57,658,106 L769* probably null Het
Hes5 A G 4: 154,961,254 K58R probably damaging Het
Heyl A G 4: 123,241,390 I59V probably damaging Het
Hpca A G 4: 129,118,600 F48L probably damaging Het
Ice1 C T 13: 70,606,218 R583Q probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kansl1l T A 1: 66,778,032 I390F probably damaging Het
Kat5 C T 19: 5,609,238 V95M possibly damaging Het
Kcnh4 T A 11: 100,745,341 I827F possibly damaging Het
Kif1b C T 4: 149,188,132 R138Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lats1 T A 10: 7,710,939 L955* probably null Het
Ldlrad2 A C 4: 137,572,184 C110G possibly damaging Het
Lgi3 G A 14: 70,534,776 probably null Het
Lingo1 A G 9: 56,620,558 M249T probably benign Het
Lrig3 A T 10: 126,013,389 R993* probably null Het
Lsm14b T A 2: 180,026,728 I74N probably damaging Het
Lyplal1 T A 1: 186,100,217 I114F probably damaging Het
Mmp15 A G 8: 95,365,420 Y86C probably damaging Het
Myh2 A G 11: 67,186,487 E816G probably benign Het
Myo5c A G 9: 75,249,735 N151S probably damaging Het
Nckap1 T A 2: 80,502,250 E1082V possibly damaging Het
Nrg4 A C 9: 55,282,606 probably benign Het
Nrp2 T C 1: 62,738,339 L101P probably damaging Het
Olfr1180 T C 2: 88,412,067 D197G probably benign Het
Olfr126 A T 17: 37,850,748 D52V probably damaging Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr638 A G 7: 104,004,117 I281V probably benign Het
Olfr992 G A 2: 85,400,168 R122C probably benign Het
Parp14 T A 16: 35,863,449 E169V probably damaging Het
Pcolce2 G A 9: 95,670,117 R101H probably damaging Het
Pcolce2 A T 9: 95,670,203 N130Y probably benign Het
Plscr1 A T 9: 92,258,074 S5C unknown Het
Plxdc2 T C 2: 16,669,856 V338A probably benign Het
Psg23 T A 7: 18,610,438 N364I possibly damaging Het
Psmg4 A G 13: 34,178,056 E109G probably damaging Het
Ptk2 T C 15: 73,210,884 E908G probably damaging Het
Ptpn14 G A 1: 189,786,851 R26H probably damaging Het
Ranbp2 T A 10: 58,478,766 N1769K probably benign Het
Rbm14 C T 19: 4,801,795 probably benign Het
Rgs7 A T 1: 175,153,148 D103E probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rock2 T A 12: 16,928,989 D93E probably benign Het
Rps6ka6 A G X: 111,420,932 I246T possibly damaging Het
Rubcn T C 16: 32,826,172 M803V possibly damaging Het
Ryr3 T C 2: 112,750,820 Y2889C probably damaging Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Selplg T C 5: 113,819,844 T134A possibly damaging Het
Sez6 C A 11: 77,953,717 T122N possibly damaging Het
Slc9b1 T A 3: 135,357,468 D4E unknown Het
Smim18 A G 8: 33,742,348 M81T probably benign Het
Snap91 A T 9: 86,815,465 H281Q probably damaging Het
Sparc C A 11: 55,395,866 C302F probably damaging Het
Spg11 A G 2: 122,101,756 L535P probably damaging Het
Spsb1 G A 4: 149,906,631 T160I probably damaging Het
Stra6 A G 9: 58,140,530 N128S probably benign Het
Strc T C 2: 121,379,296 E182G probably damaging Het
Sult2a6 A G 7: 14,254,829 M2T probably benign Het
Sv2c T C 13: 95,981,844 N499S probably benign Het
Szt2 A T 4: 118,365,657 probably benign Het
Tbx20 A T 9: 24,725,676 S372T probably benign Het
Tcp11l2 T A 10: 84,604,599 S289T probably damaging Het
Tdrd1 A G 19: 56,842,312 E259G probably damaging Het
Thsd7a T A 6: 12,330,974 I1390L probably benign Het
Tln2 G A 9: 67,342,043 R921W probably damaging Het
Tmem126a C A 7: 90,452,884 G36* probably null Het
Tmem245 C T 4: 56,903,947 V606I probably benign Het
Trpm6 A G 19: 18,866,267 D1665G probably benign Het
Ubac2 T G 14: 121,994,262 V200G probably benign Het
Ubr5 G A 15: 37,980,917 A2372V possibly damaging Het
Ugcg C T 4: 59,219,517 P285S probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r118 T A 17: 55,610,406 K369* probably null Het
Xpnpep3 G T 15: 81,427,353 A87S probably benign Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zdhhc11 A G 13: 73,974,652 N169S probably damaging Het
Zfp62 T A 11: 49,216,388 D435E probably damaging Het
Zfyve16 T C 13: 92,511,525 D1007G possibly damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 unclassified probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGCAGGTCTTTATTTTCAC -3'
(R):5'- GGATTATGCACCACATACCTTCAG -3'

Sequencing Primer
(F):5'- AGCAGGTCTTTATTTTCACTGAGTTG -3'
(R):5'- ATACCTTCAGCCTGGCAATG -3'
Posted On2014-06-23