Mutagenetix > Incidental Mutation

Incidental Mutation 'R1840:Atm'

205710

Institutional Source

Beutler Lab

Gene Symbol

Atm

Ensembl Gene

ENSMUSG00000034218

Gene Name

ataxia telangiectasia mutated

Synonyms

C030026E19Rik

MMRRC Submission

039866-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.928) question?

Stock #

R1840 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53439149-53536740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53456530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 2431 (V2431E)

Ref Sequence

ENSEMBL: ENSMUSP00000113388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000118282
AA Change: V2431E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: V2431E

Domain	Start	End	E-Value	Type
TAN	1	166	5.07e-68	SMART
low complexity region	431	445	N/A	INTRINSIC
low complexity region	830	846	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
SCOP:d1gw5a_	1039	1568	2e-4	SMART
coiled coil region	1615	1644	N/A	INTRINSIC
low complexity region	1650	1662	N/A	INTRINSIC
Pfam:FAT	2102	2499	4.4e-50	PFAM
low complexity region	2587	2599	N/A	INTRINSIC
PI3Kc	2723	3026	1.11e-117	SMART
FATC	3034	3066	3.71e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132249

SMART Domains

Protein: ENSMUSP00000118199
Gene: ENSMUSG00000034218

Domain	Start	End	E-Value	Type
PI3Kc	68	201	5.38e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000232179
AA Change: V2434E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.9243

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 95.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029I15Rik	T	C	2: 92,383,209	S36P	probably benign	Het
2510009E07Rik	T	A	16: 21,653,486	M85L	probably benign	Het
Aatk	T	G	11: 120,013,732	D206A	probably damaging	Het
Agap3	A	G	5: 24,500,231	D719G	probably damaging	Het
Agrn	G	A	4: 156,167,415	R1797C	probably damaging	Het
Ascc3	T	A	10: 50,690,161	M734K	probably benign	Het
Asph	T	A	4: 9,601,340	M136L	possibly damaging	Het
Atp2b1	A	G	10: 99,022,929	H1158R	probably benign	Het
Atxn7l1	A	G	12: 33,371,033		probably null	Het
BC024139	G	T	15: 76,120,642	S611R	probably benign	Het
Becn1	C	T	11: 101,295,566	G105S	probably damaging	Het
Bud13	A	G	9: 46,286,408	E70G	probably damaging	Het
Cacul1	A	T	19: 60,534,250	L282*	probably null	Het
Ccar1	T	A	10: 62,763,510	K614M	probably damaging	Het
Cd96	T	C	16: 46,099,092	T189A	probably benign	Het
Cdh5	C	A	8: 104,126,616	Y189*	probably null	Het
Chka	A	G	19: 3,886,460	N284S	probably benign	Het
Cntn6	A	T	6: 104,774,480	I366F	probably damaging	Het
Csmd3	C	T	15: 47,607,164	G3372E	probably damaging	Het
Cyp4f16	T	C	17: 32,543,006		probably null	Het
Dcaf6	A	G	1: 165,399,748	V270A	probably damaging	Het
Ddx60	T	A	8: 61,969,553	I608N	probably damaging	Het
Dnah9	A	T	11: 65,834,198	C1849*	probably null	Het
Eci3	C	A	13: 34,960,041	V34L	probably benign	Het
Epha1	C	T	6: 42,363,588	R583H	probably damaging	Het
Erbin	A	T	13: 103,834,947	N720K	probably benign	Het
Eya1	T	A	1: 14,229,504	R346*	probably null	Het
Fam189a1	C	A	7: 64,759,195	V484L	probably benign	Het
Fhdc1	G	A	3: 84,445,821	T699I	possibly damaging	Het
Flvcr2	T	C	12: 85,803,221	V427A	possibly damaging	Het
Fzd9	T	A	5: 135,249,571	T487S	probably benign	Het
Gas2l3	T	C	10: 89,422,251	Y160C	possibly damaging	Het
Gm10264	T	C	12: 88,329,411	V53A	probably benign	Het
Gm10269	T	C	18: 20,682,809	K52R	probably damaging	Het
Gm16432	A	G	1: 178,003,015	D30G	possibly damaging	Het
Gm8674	A	T	13: 49,901,765		noncoding transcript	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Gramd4	T	C	15: 86,130,192		probably null	Het
Gtpbp4	A	G	13: 8,979,464	L403P	probably benign	Het
H6pd	A	T	4: 149,982,050	D626E	possibly damaging	Het
Herc6	T	A	6: 57,658,106	L769*	probably null	Het
Hes5	A	G	4: 154,961,254	K58R	probably damaging	Het
Heyl	A	G	4: 123,241,390	I59V	probably damaging	Het
Hpca	A	G	4: 129,118,600	F48L	probably damaging	Het
Ice1	C	T	13: 70,606,218	R583Q	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kansl1l	T	A	1: 66,778,032	I390F	probably damaging	Het
Kat5	C	T	19: 5,609,238	V95M	possibly damaging	Het
Kcnh4	T	A	11: 100,745,341	I827F	possibly damaging	Het
Kif1b	C	T	4: 149,188,132	R138Q	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lats1	T	A	10: 7,710,939	L955*	probably null	Het
Ldlrad2	A	C	4: 137,572,184	C110G	possibly damaging	Het
Lgi3	G	A	14: 70,534,776		probably null	Het
Lingo1	A	G	9: 56,620,558	M249T	probably benign	Het
Lrig3	A	T	10: 126,013,389	R993*	probably null	Het
Lsm14b	T	A	2: 180,026,728	I74N	probably damaging	Het
Lyplal1	T	A	1: 186,100,217	I114F	probably damaging	Het
Mmp15	A	G	8: 95,365,420	Y86C	probably damaging	Het
Myh2	A	G	11: 67,186,487	E816G	probably benign	Het
Myo5c	A	G	9: 75,249,735	N151S	probably damaging	Het
Nckap1	T	A	2: 80,502,250	E1082V	possibly damaging	Het
Nrg4	A	C	9: 55,282,606		probably benign	Het
Nrp2	T	C	1: 62,738,339	L101P	probably damaging	Het
Olfr1180	T	C	2: 88,412,067	D197G	probably benign	Het
Olfr126	A	T	17: 37,850,748	D52V	probably damaging	Het
Olfr521	A	T	7: 99,767,596	T145S	probably benign	Het
Olfr638	A	G	7: 104,004,117	I281V	probably benign	Het
Olfr992	G	A	2: 85,400,168	R122C	probably benign	Het
Parp14	T	A	16: 35,863,449	E169V	probably damaging	Het
Pcolce2	G	A	9: 95,670,117	R101H	probably damaging	Het
Pcolce2	A	T	9: 95,670,203	N130Y	probably benign	Het
Plscr1	A	T	9: 92,258,074	S5C	unknown	Het
Plxdc2	T	C	2: 16,669,856	V338A	probably benign	Het
Psg23	T	A	7: 18,610,438	N364I	possibly damaging	Het
Psmg4	A	G	13: 34,178,056	E109G	probably damaging	Het
Ptk2	T	C	15: 73,210,884	E908G	probably damaging	Het
Ptpn14	G	A	1: 189,786,851	R26H	probably damaging	Het
Ranbp2	T	A	10: 58,478,766	N1769K	probably benign	Het
Rbm14	C	T	19: 4,801,795		probably benign	Het
Rgs7	A	T	1: 175,153,148	D103E	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Rock2	T	A	12: 16,928,989	D93E	probably benign	Het
Rps6ka6	A	G	X: 111,420,932	I246T	possibly damaging	Het
Rubcn	T	C	16: 32,826,172	M803V	possibly damaging	Het
Ryr3	T	C	2: 112,750,820	Y2889C	probably damaging	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Selplg	T	C	5: 113,819,844	T134A	possibly damaging	Het
Sez6	C	A	11: 77,953,717	T122N	possibly damaging	Het
Slc9b1	T	A	3: 135,357,468	D4E	unknown	Het
Smim18	A	G	8: 33,742,348	M81T	probably benign	Het
Snap91	A	T	9: 86,815,465	H281Q	probably damaging	Het
Sparc	C	A	11: 55,395,866	C302F	probably damaging	Het
Spg11	A	G	2: 122,101,756	L535P	probably damaging	Het
Spsb1	G	A	4: 149,906,631	T160I	probably damaging	Het
Stra6	A	G	9: 58,140,530	N128S	probably benign	Het
Strc	T	C	2: 121,379,296	E182G	probably damaging	Het
Sult2a6	A	G	7: 14,254,829	M2T	probably benign	Het
Sv2c	T	C	13: 95,981,844	N499S	probably benign	Het
Szt2	A	T	4: 118,365,657		probably benign	Het
Tbx20	A	T	9: 24,725,676	S372T	probably benign	Het
Tcp11l2	T	A	10: 84,604,599	S289T	probably damaging	Het
Tdrd1	A	G	19: 56,842,312	E259G	probably damaging	Het
Thsd7a	T	A	6: 12,330,974	I1390L	probably benign	Het
Tln2	G	A	9: 67,342,043	R921W	probably damaging	Het
Tmem126a	C	A	7: 90,452,884	G36*	probably null	Het
Tmem245	C	T	4: 56,903,947	V606I	probably benign	Het
Trpm6	A	G	19: 18,866,267	D1665G	probably benign	Het
Ubac2	T	G	14: 121,994,262	V200G	probably benign	Het
Ubr5	G	A	15: 37,980,917	A2372V	possibly damaging	Het
Ugcg	C	T	4: 59,219,517	P285S	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r118	T	A	17: 55,610,406	K369*	probably null	Het
Xpnpep3	G	T	15: 81,427,353	A87S	probably benign	Het
Zc3h7a	C	T	16: 11,161,026	R95H	probably damaging	Het
Zdhhc11	A	G	13: 73,974,652	N169S	probably damaging	Het
Zfp62	T	A	11: 49,216,388	D435E	probably damaging	Het
Zfyve16	T	C	13: 92,511,525	D1007G	possibly damaging	Het

Other mutations in Atm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Atm	APN	9	53524443	missense	probably damaging	1.00
IGL00466:Atm	APN	9	53499112	splice site	probably benign
IGL00567:Atm	APN	9	53503116	nonsense	probably null
IGL00702:Atm	APN	9	53511831	missense	probably benign	0.02
IGL00743:Atm	APN	9	53513116	missense	probably benign	0.00
IGL00771:Atm	APN	9	53493054	missense	probably benign	0.01
IGL00773:Atm	APN	9	53522144	missense	probably benign	0.00
IGL00819:Atm	APN	9	53518531	missense	probably damaging	1.00
IGL00864:Atm	APN	9	53533933	missense	probably damaging	0.99
IGL00985:Atm	APN	9	53459816	missense	probably damaging	0.98
IGL01109:Atm	APN	9	53490293	missense	probably damaging	1.00
IGL01120:Atm	APN	9	53461122	critical splice acceptor site	probably null
IGL01369:Atm	APN	9	53515317	missense	probably benign
IGL01374:Atm	APN	9	53531724	missense	possibly damaging	0.58
IGL01406:Atm	APN	9	53439746	makesense	probably null
IGL01409:Atm	APN	9	53499171	missense	probably benign	0.01
IGL01434:Atm	APN	9	53507807	missense	probably benign	0.04
IGL01486:Atm	APN	9	53510213	missense	probably benign
IGL01583:Atm	APN	9	53484247	splice site	probably benign
IGL01861:Atm	APN	9	53494612	missense	probably null	0.89
IGL01865:Atm	APN	9	53461002	missense	probably damaging	1.00
IGL02026:Atm	APN	9	53442417	splice site	probably null
IGL02072:Atm	APN	9	53459796	missense	probably benign	0.01
IGL02075:Atm	APN	9	53527237	missense	probably damaging	1.00
IGL02127:Atm	APN	9	53487983	missense	probably damaging	1.00
IGL02175:Atm	APN	9	53480665	missense	probably damaging	0.99
IGL02246:Atm	APN	9	53527185	missense	probably benign	0.12
IGL02259:Atm	APN	9	53518494	splice site	probably benign
IGL02351:Atm	APN	9	53522176	missense	probably benign	0.04
IGL02358:Atm	APN	9	53522176	missense	probably benign	0.04
IGL02387:Atm	APN	9	53479766	splice site	probably null
IGL02417:Atm	APN	9	53479695	missense	probably benign	0.00
IGL02422:Atm	APN	9	53500792	missense	probably damaging	1.00
IGL02445:Atm	APN	9	53454330	missense	probably benign	0.00
IGL02492:Atm	APN	9	53455859	missense	probably damaging	0.99
IGL02513:Atm	APN	9	53497262	splice site	probably benign
IGL02633:Atm	APN	9	53448153	missense	probably damaging	1.00
IGL02634:Atm	APN	9	53516563	missense	probably benign	0.00
IGL02948:Atm	APN	9	53453440	splice site	probably benign
IGL02959:Atm	APN	9	53471418	missense	probably damaging	1.00
IGL02965:Atm	APN	9	53453563	missense	probably damaging	1.00
IGL03085:Atm	APN	9	53484171	missense	possibly damaging	0.89
antebellum	UTSW	9	53518559	nonsense	probably null
bull_run	UTSW	9	53487922	missense	probably benign	0.09
Civil	UTSW	9	53492268	missense	possibly damaging	0.78
gettysburg	UTSW	9	53455988	splice site	probably null
Grant	UTSW	9	53511917	nonsense	probably null
Indicative	UTSW	9	53445376	splice site	probably null
Marker	UTSW	9	53454279	splice site	probably benign
maunder	UTSW	9	53499197	nonsense	probably null
mockingbird	UTSW	9	53516467	nonsense	probably null
mockingbird2	UTSW	9	53488587	missense	probably damaging	1.00
osphere	UTSW	9	53479673	missense	probably damaging	0.99
shiloh	UTSW	9	53465298	missense	probably damaging	1.00
Strato	UTSW	9	53503018	missense	probably damaging	1.00
thrasher	UTSW	9	53445507	missense	probably benign	0.01
Tropo	UTSW	9	53531648	missense	probably damaging	1.00
P0019:Atm	UTSW	9	53465028	splice site	probably benign
PIT4403001:Atm	UTSW	9	53500982	missense	probably benign
PIT4687001:Atm	UTSW	9	53486812	critical splice donor site	probably null
R0004:Atm	UTSW	9	53453528	splice site	probably benign
R0035:Atm	UTSW	9	53513180	missense	probably benign	0.01
R0098:Atm	UTSW	9	53518569	missense	probably benign	0.10
R0098:Atm	UTSW	9	53518569	missense	probably benign	0.10
R0201:Atm	UTSW	9	53454279	splice site	probably benign
R0304:Atm	UTSW	9	53516344	missense	probably benign	0.34
R0308:Atm	UTSW	9	53454473	splice site	probably null
R0362:Atm	UTSW	9	53458838	missense	possibly damaging	0.90
R0470:Atm	UTSW	9	53460966	missense	probably damaging	1.00
R0513:Atm	UTSW	9	53503948	missense	probably benign	0.00
R0589:Atm	UTSW	9	53490192	missense	possibly damaging	0.51
R0617:Atm	UTSW	9	53458941	nonsense	probably null
R0630:Atm	UTSW	9	53531622	splice site	probably benign
R0652:Atm	UTSW	9	53486014	missense	probably damaging	0.98
R0698:Atm	UTSW	9	53515239	missense	probably damaging	1.00
R0737:Atm	UTSW	9	53456566	missense	probably damaging	1.00
R0885:Atm	UTSW	9	53459823	missense	probably benign
R0947:Atm	UTSW	9	53504092	missense	probably benign	0.01
R0948:Atm	UTSW	9	53495958	missense	probably benign
R1144:Atm	UTSW	9	53511698	splice site	probably benign
R1252:Atm	UTSW	9	53455840	missense	probably damaging	1.00
R1295:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1296:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1419:Atm	UTSW	9	53457489	missense	probably benign	0.00
R1477:Atm	UTSW	9	53464273	missense	probably benign	0.00
R1596:Atm	UTSW	9	53453378	missense	probably damaging	1.00
R1630:Atm	UTSW	9	53479673	missense	probably damaging	0.99
R1667:Atm	UTSW	9	53500932	missense	probably damaging	1.00
R1681:Atm	UTSW	9	53522155	missense	possibly damaging	0.94
R1703:Atm	UTSW	9	53500700	missense	probably benign
R1817:Atm	UTSW	9	53492233	splice site	probably benign
R1848:Atm	UTSW	9	53468012	missense	probably benign	0.06
R1906:Atm	UTSW	9	53506568	missense	probably damaging	1.00
R1958:Atm	UTSW	9	53471418	missense	probably damaging	1.00
R2108:Atm	UTSW	9	53443997	missense	probably damaging	1.00
R2116:Atm	UTSW	9	53500969	missense	probably benign	0.36
R2134:Atm	UTSW	9	53467964	critical splice donor site	probably null
R2137:Atm	UTSW	9	53453375	missense	probably damaging	1.00
R2291:Atm	UTSW	9	53490909	splice site	probably null
R2348:Atm	UTSW	9	53492268	missense	possibly damaging	0.78
R2483:Atm	UTSW	9	53510266	missense	probably damaging	1.00
R2567:Atm	UTSW	9	53457470	missense	possibly damaging	0.72
R2897:Atm	UTSW	9	53507805	missense	probably damaging	0.99
R2939:Atm	UTSW	9	53494711	missense	probably damaging	1.00
R3008:Atm	UTSW	9	53480750	missense	probably benign	0.00
R3236:Atm	UTSW	9	53479748	missense	probably benign	0.15
R3847:Atm	UTSW	9	53503075	missense	possibly damaging	0.94
R3889:Atm	UTSW	9	53506636	splice site	probably benign
R3919:Atm	UTSW	9	53492278	missense	probably benign	0.00
R4125:Atm	UTSW	9	53450621	missense	probably damaging	1.00
R4222:Atm	UTSW	9	53480669	missense	probably benign
R4395:Atm	UTSW	9	53465227	missense	probably benign	0.09
R4466:Atm	UTSW	9	53448169	nonsense	probably null
R4502:Atm	UTSW	9	53495946	missense	possibly damaging	0.92
R4514:Atm	UTSW	9	53493039	missense	probably damaging	0.99
R4528:Atm	UTSW	9	53500759	missense	probably benign	0.39
R4593:Atm	UTSW	9	53453594	missense	possibly damaging	0.55
R4627:Atm	UTSW	9	53456506	missense	possibly damaging	0.79
R4634:Atm	UTSW	9	53531733	missense	probably benign	0.01
R4665:Atm	UTSW	9	53464229	missense	probably benign	0.00
R4672:Atm	UTSW	9	53522201	missense	probably damaging	0.99
R4741:Atm	UTSW	9	53453607	missense	probably benign	0.10
R4808:Atm	UTSW	9	53445495	missense	probably damaging	0.99
R4959:Atm	UTSW	9	53515301	missense	probably benign
R4996:Atm	UTSW	9	53524507	missense	probably benign	0.09
R5030:Atm	UTSW	9	53520109	nonsense	probably null
R5214:Atm	UTSW	9	53491027	missense	probably benign	0.09
R5260:Atm	UTSW	9	53506611	missense	probably damaging	0.99
R5311:Atm	UTSW	9	53518623	missense	probably benign	0.00
R5394:Atm	UTSW	9	53507777	critical splice donor site	probably null
R5400:Atm	UTSW	9	53503018	missense	probably damaging	1.00
R5436:Atm	UTSW	9	53459804	missense	probably benign	0.00
R5441:Atm	UTSW	9	53516467	nonsense	probably null
R5569:Atm	UTSW	9	53516450	nonsense	probably null
R5856:Atm	UTSW	9	53495955	missense	possibly damaging	0.64
R5891:Atm	UTSW	9	53497159	missense	probably benign
R5910:Atm	UTSW	9	53448080	missense	probably damaging	0.96
R6054:Atm	UTSW	9	53459873	missense	probably damaging	1.00
R6062:Atm	UTSW	9	53488587	missense	probably damaging	1.00
R6092:Atm	UTSW	9	53524414	missense	probably damaging	1.00
R6127:Atm	UTSW	9	53524509	missense	probably damaging	1.00
R6160:Atm	UTSW	9	53490959	missense	probably benign	0.04
R6267:Atm	UTSW	9	53444000	missense	probably damaging	1.00
R6273:Atm	UTSW	9	53487922	missense	probably benign	0.09
R6284:Atm	UTSW	9	53445376	splice site	probably null
R6478:Atm	UTSW	9	53490254	missense	probably damaging	1.00
R6547:Atm	UTSW	9	53440157	missense	probably damaging	1.00
R6549:Atm	UTSW	9	53493177	missense	probably benign	0.00
R6704:Atm	UTSW	9	53458853	missense	probably benign	0.02
R6715:Atm	UTSW	9	53531648	missense	probably damaging	1.00
R6737:Atm	UTSW	9	53486051	missense	probably benign	0.30
R6759:Atm	UTSW	9	53518559	nonsense	probably null
R6766:Atm	UTSW	9	53490282	missense	probably damaging	0.99
R6813:Atm	UTSW	9	53497235	missense	probably benign	0.00
R6852:Atm	UTSW	9	53482430	missense	possibly damaging	0.93
R7064:Atm	UTSW	9	53507881	missense	probably benign	0.02
R7208:Atm	UTSW	9	53512008	splice site	probably null
R7211:Atm	UTSW	9	53488560	missense	probably benign	0.01
R7220:Atm	UTSW	9	53511917	nonsense	probably null
R7336:Atm	UTSW	9	53462503	missense	possibly damaging	0.47
R7363:Atm	UTSW	9	53465298	missense	probably damaging	1.00
R7378:Atm	UTSW	9	53453437	critical splice acceptor site	probably null
R7472:Atm	UTSW	9	53448125	missense	possibly damaging	0.81
R7487:Atm	UTSW	9	53524354	missense	probably benign
R7497:Atm	UTSW	9	53511891	missense	probably benign	0.00
R7584:Atm	UTSW	9	53513127	missense	probably damaging	0.99
R7624:Atm	UTSW	9	53454768	missense	probably damaging	0.99
R7653:Atm	UTSW	9	53490302	nonsense	probably null
R7660:Atm	UTSW	9	53445507	missense	probably benign	0.01
R7679:Atm	UTSW	9	53442497	missense	probably damaging	1.00
R7720:Atm	UTSW	9	53522239	missense	possibly damaging	0.54
R8221:Atm	UTSW	9	53455988	splice site	probably null
R8247:Atm	UTSW	9	53450570	missense
R8334:Atm	UTSW	9	53522273	missense	probably benign	0.00
R8503:Atm	UTSW	9	53488052	missense	probably damaging	0.99
R8552:Atm	UTSW	9	53524497	missense	probably damaging	1.00
R8749:Atm	UTSW	9	53499197	nonsense	probably null
R8838:Atm	UTSW	9	53516551	missense	probably damaging	0.99
R9126:Atm	UTSW	9	53458834	missense	probably benign	0.01
R9131:Atm	UTSW	9	53533744	missense	probably benign	0.10
R9191:Atm	UTSW	9	53527290	missense	probably benign	0.29
R9257:Atm	UTSW	9	53495850	critical splice donor site	probably null
R9473:Atm	UTSW	9	53498972	missense	probably benign
R9558:Atm	UTSW	9	53500781	missense	probably benign	0.00
R9598:Atm	UTSW	9	53520081	missense	probably benign	0.34
R9717:Atm	UTSW	9	53516517	missense	probably damaging	1.00
R9794:Atm	UTSW	9	53518567	missense	probably benign
X0067:Atm	UTSW	9	53479694	missense	probably benign	0.00
Z1088:Atm	UTSW	9	53531687	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCCACGTACTCTGCCAAG -3'
(R):5'- TGCTGGAAGTTACGATGGC -3'

Sequencing Primer
(F):5'- CTGACTGAAGTTGTGATTAGCCAC -3'
(R):5'- TGGCAACAGCAGAGAGC -3'

Posted On

2014-06-23