Incidental Mutation 'R1840:Tcp11l2'
ID 205725
Institutional Source Beutler Lab
Gene Symbol Tcp11l2
Ensembl Gene ENSMUSG00000020034
Gene Name t-complex 11 (mouse) like 2
Synonyms E430026E19Rik
MMRRC Submission 039866-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R1840 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 84412811-84450219 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84440463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 289 (S289T)
Ref Sequence ENSEMBL: ENSMUSP00000020223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020223]
AlphaFold Q8K1H7
Predicted Effect probably damaging
Transcript: ENSMUST00000020223
AA Change: S289T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020223
Gene: ENSMUSG00000020034
AA Change: S289T

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:Tcp11 77 497 5.8e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160057
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,472,236 (GRCm39) M85L probably benign Het
Aatk T G 11: 119,904,558 (GRCm39) D206A probably damaging Het
Agap3 A G 5: 24,705,229 (GRCm39) D719G probably damaging Het
Agrn G A 4: 156,251,872 (GRCm39) R1797C probably damaging Het
Ascc3 T A 10: 50,566,257 (GRCm39) M734K probably benign Het
Asph T A 4: 9,601,340 (GRCm39) M136L possibly damaging Het
Atm A T 9: 53,367,830 (GRCm39) V2431E probably damaging Het
Atp2b1 A G 10: 98,858,791 (GRCm39) H1158R probably benign Het
Atxn7l1 A G 12: 33,421,032 (GRCm39) probably null Het
BC024139 G T 15: 76,004,842 (GRCm39) S611R probably benign Het
Becn1 C T 11: 101,186,392 (GRCm39) G105S probably damaging Het
Bud13 A G 9: 46,197,706 (GRCm39) E70G probably damaging Het
Cacul1 A T 19: 60,522,688 (GRCm39) L282* probably null Het
Catspere2 A G 1: 177,830,581 (GRCm39) D30G possibly damaging Het
Ccar1 T A 10: 62,599,289 (GRCm39) K614M probably damaging Het
Cd96 T C 16: 45,919,455 (GRCm39) T189A probably benign Het
Cdh5 C A 8: 104,853,248 (GRCm39) Y189* probably null Het
Chka A G 19: 3,936,460 (GRCm39) N284S probably benign Het
Cntn6 A T 6: 104,751,441 (GRCm39) I366F probably damaging Het
Csmd3 C T 15: 47,470,560 (GRCm39) G3372E probably damaging Het
Cyp4f16 T C 17: 32,761,980 (GRCm39) probably null Het
Dcaf6 A G 1: 165,227,317 (GRCm39) V270A probably damaging Het
Ddx60 T A 8: 62,422,587 (GRCm39) I608N probably damaging Het
Dnah9 A T 11: 65,725,024 (GRCm39) C1849* probably null Het
Eci3 C A 13: 35,144,024 (GRCm39) V34L probably benign Het
Eif1ad9 T C 12: 88,296,181 (GRCm39) V53A probably benign Het
Entrep2 C A 7: 64,408,943 (GRCm39) V484L probably benign Het
Epha1 C T 6: 42,340,522 (GRCm39) R583H probably damaging Het
Erbin A T 13: 103,971,455 (GRCm39) N720K probably benign Het
Eya1 T A 1: 14,299,728 (GRCm39) R346* probably null Het
Fhdc1 G A 3: 84,353,128 (GRCm39) T699I possibly damaging Het
Flvcr2 T C 12: 85,849,995 (GRCm39) V427A possibly damaging Het
Frey1 T C 2: 92,213,554 (GRCm39) S36P probably benign Het
Fzd9 T A 5: 135,278,425 (GRCm39) T487S probably benign Het
Gas2l3 T C 10: 89,258,113 (GRCm39) Y160C possibly damaging Het
Gm10269 T C 18: 20,815,866 (GRCm39) K52R probably damaging Het
Gm8674 A T 13: 50,055,801 (GRCm39) noncoding transcript Het
Gpr61 A G 3: 108,057,797 (GRCm39) V288A possibly damaging Het
Gramd4 T C 15: 86,014,393 (GRCm39) probably null Het
Gtpbp4 A G 13: 9,029,500 (GRCm39) L403P probably benign Het
H6pd A T 4: 150,066,507 (GRCm39) D626E possibly damaging Het
Herc6 T A 6: 57,635,091 (GRCm39) L769* probably null Het
Hes5 A G 4: 155,045,711 (GRCm39) K58R probably damaging Het
Heyl A G 4: 123,135,183 (GRCm39) I59V probably damaging Het
Hpca A G 4: 129,012,393 (GRCm39) F48L probably damaging Het
Ice1 C T 13: 70,754,337 (GRCm39) R583Q probably benign Het
Ints2 C T 11: 86,123,911 (GRCm39) G626R probably damaging Het
Kansl1l T A 1: 66,817,191 (GRCm39) I390F probably damaging Het
Kat5 C T 19: 5,659,266 (GRCm39) V95M possibly damaging Het
Kcnh4 T A 11: 100,636,167 (GRCm39) I827F possibly damaging Het
Kif1b C T 4: 149,272,589 (GRCm39) R138Q probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lats1 T A 10: 7,586,703 (GRCm39) L955* probably null Het
Ldlrad2 A C 4: 137,299,495 (GRCm39) C110G possibly damaging Het
Lgi3 G A 14: 70,772,216 (GRCm39) probably null Het
Lingo1 A G 9: 56,527,842 (GRCm39) M249T probably benign Het
Lrig3 A T 10: 125,849,258 (GRCm39) R993* probably null Het
Lsm14b T A 2: 179,668,521 (GRCm39) I74N probably damaging Het
Lyplal1 T A 1: 185,832,414 (GRCm39) I114F probably damaging Het
Mmp15 A G 8: 96,092,048 (GRCm39) Y86C probably damaging Het
Myh2 A G 11: 67,077,313 (GRCm39) E816G probably benign Het
Myo5c A G 9: 75,157,017 (GRCm39) N151S probably damaging Het
Nckap1 T A 2: 80,332,594 (GRCm39) E1082V possibly damaging Het
Nrg4 A C 9: 55,189,890 (GRCm39) probably benign Het
Nrp2 T C 1: 62,777,498 (GRCm39) L101P probably damaging Het
Or14j5 A T 17: 38,161,639 (GRCm39) D52V probably damaging Het
Or2at1 A T 7: 99,416,803 (GRCm39) T145S probably benign Het
Or4p19 T C 2: 88,242,411 (GRCm39) D197G probably benign Het
Or51q1c A G 7: 103,653,324 (GRCm39) I281V probably benign Het
Or5ak22 G A 2: 85,230,512 (GRCm39) R122C probably benign Het
Parp14 T A 16: 35,683,819 (GRCm39) E169V probably damaging Het
Pcolce2 A T 9: 95,552,256 (GRCm39) N130Y probably benign Het
Pcolce2 G A 9: 95,552,170 (GRCm39) R101H probably damaging Het
Plscr1 A T 9: 92,140,127 (GRCm39) S5C unknown Het
Plxdc2 T C 2: 16,674,667 (GRCm39) V338A probably benign Het
Psg23 T A 7: 18,344,363 (GRCm39) N364I possibly damaging Het
Psmg4 A G 13: 34,362,039 (GRCm39) E109G probably damaging Het
Ptk2 T C 15: 73,082,733 (GRCm39) E908G probably damaging Het
Ptpn14 G A 1: 189,519,048 (GRCm39) R26H probably damaging Het
Ranbp2 T A 10: 58,314,588 (GRCm39) N1769K probably benign Het
Rbm14 C T 19: 4,851,823 (GRCm39) probably benign Het
Rgs7 A T 1: 174,980,714 (GRCm39) D103E probably damaging Het
Rmnd5a G A 6: 71,375,439 (GRCm39) L80F probably benign Het
Rock2 T A 12: 16,978,990 (GRCm39) D93E probably benign Het
Rps6ka6 A G X: 110,330,629 (GRCm39) I246T possibly damaging Het
Rubcn T C 16: 32,646,542 (GRCm39) M803V possibly damaging Het
Ryr3 T C 2: 112,581,165 (GRCm39) Y2889C probably damaging Het
Sall2 T C 14: 52,551,182 (GRCm39) N671S probably damaging Het
Selplg T C 5: 113,957,905 (GRCm39) T134A possibly damaging Het
Sez6 C A 11: 77,844,543 (GRCm39) T122N possibly damaging Het
Slc9b1 T A 3: 135,063,229 (GRCm39) D4E unknown Het
Smim18 A G 8: 34,232,376 (GRCm39) M81T probably benign Het
Snap91 A T 9: 86,697,518 (GRCm39) H281Q probably damaging Het
Sparc C A 11: 55,286,692 (GRCm39) C302F probably damaging Het
Spg11 A G 2: 121,932,237 (GRCm39) L535P probably damaging Het
Spsb1 G A 4: 149,991,088 (GRCm39) T160I probably damaging Het
Stra6 A G 9: 58,047,813 (GRCm39) N128S probably benign Het
Strc T C 2: 121,209,777 (GRCm39) E182G probably damaging Het
Sult2a6 A G 7: 13,988,754 (GRCm39) M2T probably benign Het
Sv2c T C 13: 96,118,352 (GRCm39) N499S probably benign Het
Szt2 A T 4: 118,222,854 (GRCm39) probably benign Het
Tbx20 A T 9: 24,636,972 (GRCm39) S372T probably benign Het
Tdrd1 A G 19: 56,830,744 (GRCm39) E259G probably damaging Het
Thsd7a T A 6: 12,330,973 (GRCm39) I1390L probably benign Het
Tln2 G A 9: 67,249,325 (GRCm39) R921W probably damaging Het
Tmem126a C A 7: 90,102,092 (GRCm39) G36* probably null Het
Tmem245 C T 4: 56,903,947 (GRCm39) V606I probably benign Het
Trpm6 A G 19: 18,843,631 (GRCm39) D1665G probably benign Het
Ubac2 T G 14: 122,231,674 (GRCm39) V200G probably benign Het
Ubr5 G A 15: 37,981,161 (GRCm39) A2372V possibly damaging Het
Ugcg C T 4: 59,219,517 (GRCm39) P285S probably damaging Het
Vmn1r9 T C 6: 57,048,522 (GRCm39) V199A probably damaging Het
Vmn2r118 T A 17: 55,917,406 (GRCm39) K369* probably null Het
Xpnpep3 G T 15: 81,311,554 (GRCm39) A87S probably benign Het
Zc3h7a C T 16: 10,978,890 (GRCm39) R95H probably damaging Het
Zdhhc11 A G 13: 74,122,771 (GRCm39) N169S probably damaging Het
Zfp62 T A 11: 49,107,215 (GRCm39) D435E probably damaging Het
Zfyve16 T C 13: 92,648,033 (GRCm39) D1007G possibly damaging Het
Other mutations in Tcp11l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Tcp11l2 APN 10 84,430,574 (GRCm39) missense possibly damaging 0.82
IGL00845:Tcp11l2 APN 10 84,440,847 (GRCm39) missense possibly damaging 0.95
IGL02375:Tcp11l2 APN 10 84,440,932 (GRCm39) critical splice donor site probably null
IGL02418:Tcp11l2 APN 10 84,449,470 (GRCm39) nonsense probably null
IGL03325:Tcp11l2 APN 10 84,440,764 (GRCm39) missense possibly damaging 0.76
R0031:Tcp11l2 UTSW 10 84,427,004 (GRCm39) missense probably damaging 0.98
R0591:Tcp11l2 UTSW 10 84,440,458 (GRCm39) missense probably benign 0.05
R1563:Tcp11l2 UTSW 10 84,420,808 (GRCm39) missense probably damaging 0.96
R1607:Tcp11l2 UTSW 10 84,449,351 (GRCm39) missense probably damaging 1.00
R2144:Tcp11l2 UTSW 10 84,449,363 (GRCm39) missense probably damaging 1.00
R2251:Tcp11l2 UTSW 10 84,440,933 (GRCm39) critical splice donor site probably null
R4289:Tcp11l2 UTSW 10 84,440,937 (GRCm39) splice site probably null
R4639:Tcp11l2 UTSW 10 84,420,800 (GRCm39) missense probably damaging 1.00
R4844:Tcp11l2 UTSW 10 84,449,555 (GRCm39) missense probably benign 0.00
R4973:Tcp11l2 UTSW 10 84,427,027 (GRCm39) missense probably damaging 0.98
R5264:Tcp11l2 UTSW 10 84,449,524 (GRCm39) missense probably damaging 1.00
R5970:Tcp11l2 UTSW 10 84,430,661 (GRCm39) splice site probably benign
R6966:Tcp11l2 UTSW 10 84,427,133 (GRCm39) missense possibly damaging 0.79
R7250:Tcp11l2 UTSW 10 84,423,105 (GRCm39) critical splice donor site probably null
R7535:Tcp11l2 UTSW 10 84,430,523 (GRCm39) missense possibly damaging 0.67
R7565:Tcp11l2 UTSW 10 84,422,998 (GRCm39) missense probably damaging 1.00
R7619:Tcp11l2 UTSW 10 84,430,622 (GRCm39) missense probably damaging 1.00
R7774:Tcp11l2 UTSW 10 84,440,847 (GRCm39) missense possibly damaging 0.95
R8145:Tcp11l2 UTSW 10 84,444,480 (GRCm39) missense probably damaging 1.00
R8379:Tcp11l2 UTSW 10 84,449,469 (GRCm39) missense probably damaging 1.00
R8458:Tcp11l2 UTSW 10 84,449,396 (GRCm39) nonsense probably null
R8821:Tcp11l2 UTSW 10 84,449,522 (GRCm39) missense probably damaging 1.00
R8831:Tcp11l2 UTSW 10 84,449,522 (GRCm39) missense probably damaging 1.00
RF008:Tcp11l2 UTSW 10 84,449,388 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTAAGAACTTAGGGTCATGGCAG -3'
(R):5'- ACACATACGGACCCTCTGATTC -3'

Sequencing Primer
(F):5'- GGACCTTCTTAGAAATCTGTCATGG -3'
(R):5'- CCTCTGATTCAGGGTCAAAGTCGAG -3'
Posted On 2014-06-23