Mutagenetix > Incidental Mutation

Incidental Mutation 'R1840:Dnah9'

205731

Institutional Source

Beutler Lab

Gene Symbol

Dnah9

Ensembl Gene

ENSMUSG00000056752

Gene Name

dynein, axonemal, heavy chain 9

Synonyms

D11Ertd686e, Dnahc9

MMRRC Submission

039866-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.346) question?

Stock #

R1840 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65831282-66168551 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 65834198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1849 (C1849*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018491] [ENSMUST00000071465] [ENSMUST00000080665]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000018491

SMART Domains

Protein: ENSMUSP00000018491
Gene: ENSMUSG00000018347

Domain	Start	End	E-Value	Type
SCAN	37	149	2.75e-57	SMART
KRAB	223	280	4.18e-3	SMART
ZnF_C2H2	415	437	1.08e-1	SMART
ZnF_C2H2	443	465	4.72e-2	SMART
ZnF_C2H2	471	493	1.67e-2	SMART
ZnF_C2H2	499	521	4.94e-5	SMART
ZnF_C2H2	527	549	1.72e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000071465

SMART Domains

Protein: ENSMUSP00000071406
Gene: ENSMUSG00000018347

Domain	Start	End	E-Value	Type
SCAN	37	149	2.75e-57	SMART
KRAB	223	280	4.18e-3	SMART
ZnF_C2H2	415	437	1.08e-1	SMART
ZnF_C2H2	443	465	4.72e-2	SMART
ZnF_C2H2	471	493	1.67e-2	SMART
ZnF_C2H2	499	521	4.94e-5	SMART
ZnF_C2H2	527	549	1.72e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000080665
AA Change: C4376*

SMART Domains

Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: C4376*

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	209	787	3.6e-164	PFAM
coiled coil region	788	820	N/A	INTRINSIC
low complexity region	1228	1240	N/A	INTRINSIC
Pfam:DHC_N2	1290	1699	1.4e-134	PFAM
AAA	1863	1999	4.9e-1	SMART
AAA	2141	2341	1.99e0	SMART
AAA	2468	2614	6.75e-1	SMART
Pfam:AAA_8	2786	3053	1.1e-165	PFAM
Pfam:MT	3065	3408	7.2e-208	PFAM
Pfam:AAA_9	3430	3652	3.2e-87	PFAM
Pfam:Dynein_heavy	3786	4482	1e-241	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000152386
AA Change: C1849*

SMART Domains

Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: C1849*

Domain	Start	End	E-Value	Type
Pfam:AAA_7	1	258	3e-155	PFAM
Pfam:AAA_8	336	603	3.9e-166	PFAM
Pfam:MT	615	958	2.3e-208	PFAM
Pfam:AAA_9	980	1202	1.1e-87	PFAM
Pfam:Dynein_heavy	1336	1514	2.4e-52	PFAM
Pfam:Dynein_heavy	1508	1956	8.6e-155	PFAM

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 95.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029I15Rik	T	C	2: 92,383,209	S36P	probably benign	Het
2510009E07Rik	T	A	16: 21,653,486	M85L	probably benign	Het
Aatk	T	G	11: 120,013,732	D206A	probably damaging	Het
Agap3	A	G	5: 24,500,231	D719G	probably damaging	Het
Agrn	G	A	4: 156,167,415	R1797C	probably damaging	Het
Ascc3	T	A	10: 50,690,161	M734K	probably benign	Het
Asph	T	A	4: 9,601,340	M136L	possibly damaging	Het
Atm	A	T	9: 53,456,530	V2431E	probably damaging	Het
Atp2b1	A	G	10: 99,022,929	H1158R	probably benign	Het
Atxn7l1	A	G	12: 33,371,033		probably null	Het
BC024139	G	T	15: 76,120,642	S611R	probably benign	Het
Becn1	C	T	11: 101,295,566	G105S	probably damaging	Het
Bud13	A	G	9: 46,286,408	E70G	probably damaging	Het
Cacul1	A	T	19: 60,534,250	L282*	probably null	Het
Ccar1	T	A	10: 62,763,510	K614M	probably damaging	Het
Cd96	T	C	16: 46,099,092	T189A	probably benign	Het
Cdh5	C	A	8: 104,126,616	Y189*	probably null	Het
Chka	A	G	19: 3,886,460	N284S	probably benign	Het
Cntn6	A	T	6: 104,774,480	I366F	probably damaging	Het
Csmd3	C	T	15: 47,607,164	G3372E	probably damaging	Het
Cyp4f16	T	C	17: 32,543,006		probably null	Het
Dcaf6	A	G	1: 165,399,748	V270A	probably damaging	Het
Ddx60	T	A	8: 61,969,553	I608N	probably damaging	Het
Eci3	C	A	13: 34,960,041	V34L	probably benign	Het
Epha1	C	T	6: 42,363,588	R583H	probably damaging	Het
Erbin	A	T	13: 103,834,947	N720K	probably benign	Het
Eya1	T	A	1: 14,229,504	R346*	probably null	Het
Fam189a1	C	A	7: 64,759,195	V484L	probably benign	Het
Fhdc1	G	A	3: 84,445,821	T699I	possibly damaging	Het
Flvcr2	T	C	12: 85,803,221	V427A	possibly damaging	Het
Fzd9	T	A	5: 135,249,571	T487S	probably benign	Het
Gas2l3	T	C	10: 89,422,251	Y160C	possibly damaging	Het
Gm10264	T	C	12: 88,329,411	V53A	probably benign	Het
Gm10269	T	C	18: 20,682,809	K52R	probably damaging	Het
Gm16432	A	G	1: 178,003,015	D30G	possibly damaging	Het
Gm8674	A	T	13: 49,901,765		noncoding transcript	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Gramd4	T	C	15: 86,130,192		probably null	Het
Gtpbp4	A	G	13: 8,979,464	L403P	probably benign	Het
H6pd	A	T	4: 149,982,050	D626E	possibly damaging	Het
Herc6	T	A	6: 57,658,106	L769*	probably null	Het
Hes5	A	G	4: 154,961,254	K58R	probably damaging	Het
Heyl	A	G	4: 123,241,390	I59V	probably damaging	Het
Hpca	A	G	4: 129,118,600	F48L	probably damaging	Het
Ice1	C	T	13: 70,606,218	R583Q	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kansl1l	T	A	1: 66,778,032	I390F	probably damaging	Het
Kat5	C	T	19: 5,609,238	V95M	possibly damaging	Het
Kcnh4	T	A	11: 100,745,341	I827F	possibly damaging	Het
Kif1b	C	T	4: 149,188,132	R138Q	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lats1	T	A	10: 7,710,939	L955*	probably null	Het
Ldlrad2	A	C	4: 137,572,184	C110G	possibly damaging	Het
Lgi3	G	A	14: 70,534,776		probably null	Het
Lingo1	A	G	9: 56,620,558	M249T	probably benign	Het
Lrig3	A	T	10: 126,013,389	R993*	probably null	Het
Lsm14b	T	A	2: 180,026,728	I74N	probably damaging	Het
Lyplal1	T	A	1: 186,100,217	I114F	probably damaging	Het
Mmp15	A	G	8: 95,365,420	Y86C	probably damaging	Het
Myh2	A	G	11: 67,186,487	E816G	probably benign	Het
Myo5c	A	G	9: 75,249,735	N151S	probably damaging	Het
Nckap1	T	A	2: 80,502,250	E1082V	possibly damaging	Het
Nrg4	A	C	9: 55,282,606		probably benign	Het
Nrp2	T	C	1: 62,738,339	L101P	probably damaging	Het
Olfr1180	T	C	2: 88,412,067	D197G	probably benign	Het
Olfr126	A	T	17: 37,850,748	D52V	probably damaging	Het
Olfr521	A	T	7: 99,767,596	T145S	probably benign	Het
Olfr638	A	G	7: 104,004,117	I281V	probably benign	Het
Olfr992	G	A	2: 85,400,168	R122C	probably benign	Het
Parp14	T	A	16: 35,863,449	E169V	probably damaging	Het
Pcolce2	G	A	9: 95,670,117	R101H	probably damaging	Het
Pcolce2	A	T	9: 95,670,203	N130Y	probably benign	Het
Plscr1	A	T	9: 92,258,074	S5C	unknown	Het
Plxdc2	T	C	2: 16,669,856	V338A	probably benign	Het
Psg23	T	A	7: 18,610,438	N364I	possibly damaging	Het
Psmg4	A	G	13: 34,178,056	E109G	probably damaging	Het
Ptk2	T	C	15: 73,210,884	E908G	probably damaging	Het
Ptpn14	G	A	1: 189,786,851	R26H	probably damaging	Het
Ranbp2	T	A	10: 58,478,766	N1769K	probably benign	Het
Rbm14	C	T	19: 4,801,795		probably benign	Het
Rgs7	A	T	1: 175,153,148	D103E	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Rock2	T	A	12: 16,928,989	D93E	probably benign	Het
Rps6ka6	A	G	X: 111,420,932	I246T	possibly damaging	Het
Rubcn	T	C	16: 32,826,172	M803V	possibly damaging	Het
Ryr3	T	C	2: 112,750,820	Y2889C	probably damaging	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Selplg	T	C	5: 113,819,844	T134A	possibly damaging	Het
Sez6	C	A	11: 77,953,717	T122N	possibly damaging	Het
Slc9b1	T	A	3: 135,357,468	D4E	unknown	Het
Smim18	A	G	8: 33,742,348	M81T	probably benign	Het
Snap91	A	T	9: 86,815,465	H281Q	probably damaging	Het
Sparc	C	A	11: 55,395,866	C302F	probably damaging	Het
Spg11	A	G	2: 122,101,756	L535P	probably damaging	Het
Spsb1	G	A	4: 149,906,631	T160I	probably damaging	Het
Stra6	A	G	9: 58,140,530	N128S	probably benign	Het
Strc	T	C	2: 121,379,296	E182G	probably damaging	Het
Sult2a6	A	G	7: 14,254,829	M2T	probably benign	Het
Sv2c	T	C	13: 95,981,844	N499S	probably benign	Het
Szt2	A	T	4: 118,365,657		probably benign	Het
Tbx20	A	T	9: 24,725,676	S372T	probably benign	Het
Tcp11l2	T	A	10: 84,604,599	S289T	probably damaging	Het
Tdrd1	A	G	19: 56,842,312	E259G	probably damaging	Het
Thsd7a	T	A	6: 12,330,974	I1390L	probably benign	Het
Tln2	G	A	9: 67,342,043	R921W	probably damaging	Het
Tmem126a	C	A	7: 90,452,884	G36*	probably null	Het
Tmem245	C	T	4: 56,903,947	V606I	probably benign	Het
Trpm6	A	G	19: 18,866,267	D1665G	probably benign	Het
Ubac2	T	G	14: 121,994,262	V200G	probably benign	Het
Ubr5	G	A	15: 37,980,917	A2372V	possibly damaging	Het
Ugcg	C	T	4: 59,219,517	P285S	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r118	T	A	17: 55,610,406	K369*	probably null	Het
Xpnpep3	G	T	15: 81,427,353	A87S	probably benign	Het
Zc3h7a	C	T	16: 11,161,026	R95H	probably damaging	Het
Zdhhc11	A	G	13: 73,974,652	N169S	probably damaging	Het
Zfp62	T	A	11: 49,216,388	D435E	probably damaging	Het
Zfyve16	T	C	13: 92,511,525	D1007G	possibly damaging	Het

Other mutations in Dnah9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00696:Dnah9	APN	11	65841238	splice site	probably benign
IGL00805:Dnah9	APN	11	65881695	missense	probably benign	0.00
IGL00826:Dnah9	APN	11	65989942	missense	probably damaging	1.00
IGL01108:Dnah9	APN	11	65849980	missense	possibly damaging	0.93
IGL01152:Dnah9	APN	11	66072056	missense	probably damaging	1.00
IGL01353:Dnah9	APN	11	66080571	missense	probably damaging	1.00
IGL01364:Dnah9	APN	11	66155459	missense	probably damaging	1.00
IGL01479:Dnah9	APN	11	65955717	missense	probably benign	0.14
IGL01537:Dnah9	APN	11	65947680	missense	probably benign
IGL01565:Dnah9	APN	11	66033829	missense	possibly damaging	0.95
IGL01597:Dnah9	APN	11	66118830	missense	probably damaging	1.00
IGL01619:Dnah9	APN	11	65831615	nonsense	probably null
IGL01625:Dnah9	APN	11	66044645	missense	probably damaging	1.00
IGL01803:Dnah9	APN	11	66118829	missense	probably damaging	1.00
IGL01819:Dnah9	APN	11	66108126	missense	probably benign	0.33
IGL01896:Dnah9	APN	11	66130666	missense	possibly damaging	0.89
IGL01922:Dnah9	APN	11	66075034	splice site	probably benign
IGL01923:Dnah9	APN	11	66125235	splice site	probably benign
IGL02059:Dnah9	APN	11	66072958	missense	probably damaging	1.00
IGL02068:Dnah9	APN	11	66061045	missense	probably damaging	1.00
IGL02135:Dnah9	APN	11	66117492	missense	possibly damaging	0.63
IGL02146:Dnah9	APN	11	65927700	missense	probably damaging	1.00
IGL02264:Dnah9	APN	11	66080488	splice site	probably benign
IGL02325:Dnah9	APN	11	65834217	missense	probably damaging	1.00
IGL02426:Dnah9	APN	11	66125153	missense	probably benign
IGL02440:Dnah9	APN	11	65955246	missense	probably damaging	1.00
IGL02471:Dnah9	APN	11	65947618	nonsense	probably null
IGL02496:Dnah9	APN	11	66029363	missense	probably damaging	1.00
IGL02672:Dnah9	APN	11	65927601	missense	probably benign	0.02
IGL02718:Dnah9	APN	11	65886640	missense	probably damaging	0.99
IGL02832:Dnah9	APN	11	66040346	missense	probably damaging	1.00
IGL02851:Dnah9	APN	11	66037744	splice site	probably benign
IGL02859:Dnah9	APN	11	65881619	splice site	probably benign
IGL02864:Dnah9	APN	11	66061003	missense	probably damaging	1.00
IGL02954:Dnah9	APN	11	66118967	missense	probably damaging	1.00
IGL02987:Dnah9	APN	11	65855272	missense	probably damaging	0.98
IGL02987:Dnah9	APN	11	65841273	missense	probably benign	0.23
IGL03160:Dnah9	APN	11	66108054	missense	probably damaging	0.98
IGL03171:Dnah9	APN	11	65981241	missense	probably benign	0.13
IGL03180:Dnah9	APN	11	65886639	missense	probably damaging	0.99
IGL03388:Dnah9	APN	11	65947542	missense	probably damaging	1.00
anarchy	UTSW	11	65955248	missense	probably damaging	0.99
sacco	UTSW	11	66168079	missense	possibly damaging	0.82
Tweed	UTSW	11	66072072	missense	probably damaging	0.99
vanzetti	UTSW	11	65855372	nonsense	probably null
IGL02837:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
PIT4280001:Dnah9	UTSW	11	66005013	missense	probably benign	0.44
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0070:Dnah9	UTSW	11	66160040	missense	probably benign	0.10
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0180:Dnah9	UTSW	11	66147290	missense	probably damaging	1.00
R0195:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R0230:Dnah9	UTSW	11	65855315	missense	probably damaging	1.00
R0243:Dnah9	UTSW	11	65911852	missense	possibly damaging	0.91
R0279:Dnah9	UTSW	11	65911789	critical splice donor site	probably null
R0288:Dnah9	UTSW	11	66025134	critical splice donor site	probably null
R0309:Dnah9	UTSW	11	66026972	splice site	probably benign
R0356:Dnah9	UTSW	11	66130562	critical splice donor site	probably null
R0403:Dnah9	UTSW	11	66084789	missense	possibly damaging	0.90
R0413:Dnah9	UTSW	11	66108135	missense	probably damaging	1.00
R0448:Dnah9	UTSW	11	65918713	splice site	probably benign
R0496:Dnah9	UTSW	11	66075135	missense	probably null	1.00
R0557:Dnah9	UTSW	11	66084666	missense	probably damaging	1.00
R0584:Dnah9	UTSW	11	65990489	missense	probably damaging	1.00
R0598:Dnah9	UTSW	11	66118877	missense	probably benign	0.02
R0599:Dnah9	UTSW	11	65965689	missense	probably damaging	1.00
R0606:Dnah9	UTSW	11	65841333	missense	probably damaging	1.00
R0666:Dnah9	UTSW	11	66085458	missense	probably benign	0.01
R0715:Dnah9	UTSW	11	66081248	splice site	probably benign
R0726:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R0737:Dnah9	UTSW	11	66107898	missense	probably damaging	1.00
R0763:Dnah9	UTSW	11	66155530	missense	probably benign	0.30
R0792:Dnah9	UTSW	11	65896001	missense	possibly damaging	0.84
R0829:Dnah9	UTSW	11	66005176	missense	probably benign	0.00
R0973:Dnah9	UTSW	11	66005837	splice site	probably null
R0974:Dnah9	UTSW	11	66005837	splice site	probably null
R1055:Dnah9	UTSW	11	66160011	missense	probably damaging	1.00
R1081:Dnah9	UTSW	11	66084877	missense	probably damaging	0.99
R1184:Dnah9	UTSW	11	66084612	critical splice donor site	probably null
R1225:Dnah9	UTSW	11	65871060	missense	possibly damaging	0.94
R1304:Dnah9	UTSW	11	65927588	missense	probably damaging	0.98
R1417:Dnah9	UTSW	11	65955747	missense	probably damaging	0.96
R1439:Dnah9	UTSW	11	65874132	missense	probably benign	0.22
R1447:Dnah9	UTSW	11	66108482	missense	possibly damaging	0.65
R1450:Dnah9	UTSW	11	65927786	missense	probably damaging	1.00
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1486:Dnah9	UTSW	11	65834272	missense	probably damaging	1.00
R1519:Dnah9	UTSW	11	65881761	missense	probably damaging	0.96
R1570:Dnah9	UTSW	11	66112330	missense	probably benign
R1617:Dnah9	UTSW	11	65895921	missense	probably damaging	1.00
R1623:Dnah9	UTSW	11	66037637	missense	probably damaging	1.00
R1626:Dnah9	UTSW	11	66085267	missense	probably benign	0.05
R1671:Dnah9	UTSW	11	65927963	missense	probably damaging	0.99
R1694:Dnah9	UTSW	11	65954824	nonsense	probably null
R1701:Dnah9	UTSW	11	65911924	missense	probably damaging	1.00
R1702:Dnah9	UTSW	11	66085195	missense	possibly damaging	0.72
R1708:Dnah9	UTSW	11	65915154	missense	probably benign	0.11
R1718:Dnah9	UTSW	11	66168079	missense	possibly damaging	0.82
R1729:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1760:Dnah9	UTSW	11	65981222	missense	probably benign	0.31
R1784:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1793:Dnah9	UTSW	11	66119594	critical splice donor site	probably null
R1801:Dnah9	UTSW	11	65955297	missense	probably damaging	0.99
R1827:Dnah9	UTSW	11	65850061	missense	probably damaging	0.97
R1836:Dnah9	UTSW	11	66118841	missense	probably benign	0.10
R1847:Dnah9	UTSW	11	65834386	missense	probably damaging	1.00
R1872:Dnah9	UTSW	11	66037490	missense	probably benign	0.16
R1929:Dnah9	UTSW	11	65976398	missense	probably benign	0.05
R1969:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R1971:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R2027:Dnah9	UTSW	11	65955338	missense	probably benign	0.11
R2049:Dnah9	UTSW	11	66044683	missense	probably damaging	1.00
R2064:Dnah9	UTSW	11	66145435	missense	probably benign	0.31
R2104:Dnah9	UTSW	11	66061124	missense	probably damaging	1.00
R2109:Dnah9	UTSW	11	66037585	missense	probably damaging	1.00
R2160:Dnah9	UTSW	11	66117483	missense	probably damaging	1.00
R2172:Dnah9	UTSW	11	66072779	missense	probably damaging	1.00
R2198:Dnah9	UTSW	11	65859499	missense	possibly damaging	0.50
R2271:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2272:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2396:Dnah9	UTSW	11	66085158	missense	probably benign	0.01
R2398:Dnah9	UTSW	11	65915203	missense	probably damaging	1.00
R2418:Dnah9	UTSW	11	66095415	nonsense	probably null
R2419:Dnah9	UTSW	11	66095415	nonsense	probably null
R2510:Dnah9	UTSW	11	66005169	missense	probably damaging	1.00
R2680:Dnah9	UTSW	11	66033925	missense	probably benign	0.00
R2875:Dnah9	UTSW	11	66168461	missense	possibly damaging	0.89
R2979:Dnah9	UTSW	11	66117588	missense	possibly damaging	0.89
R3236:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3237:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3433:Dnah9	UTSW	11	66075112	missense	possibly damaging	0.85
R3737:Dnah9	UTSW	11	66156908	nonsense	probably null
R3820:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3821:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3822:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3861:Dnah9	UTSW	11	66052994	splice site	probably benign
R3918:Dnah9	UTSW	11	65870974	missense	possibly damaging	0.54
R4011:Dnah9	UTSW	11	65834464	missense	probably damaging	0.98
R4044:Dnah9	UTSW	11	66133635	missense	probably benign	0.03
R4072:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4076:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4097:Dnah9	UTSW	11	65990459	missense	probably damaging	1.00
R4409:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4410:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4417:Dnah9	UTSW	11	65981214	missense	possibly damaging	0.75
R4420:Dnah9	UTSW	11	66118749	missense	probably benign	0.00
R4434:Dnah9	UTSW	11	66108075	missense	possibly damaging	0.67
R4451:Dnah9	UTSW	11	65881641	missense	probably benign	0.07
R4452:Dnah9	UTSW	11	66027082	missense	probably damaging	0.96
R4454:Dnah9	UTSW	11	66147389	missense	probably damaging	0.96
R4551:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4552:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4590:Dnah9	UTSW	11	66040392	missense	probably damaging	1.00
R4595:Dnah9	UTSW	11	66168152	missense	probably benign
R4655:Dnah9	UTSW	11	65955732	missense	probably benign	0.00
R4667:Dnah9	UTSW	11	66155531	missense	probably benign
R4718:Dnah9	UTSW	11	66085473	missense	probably benign
R4720:Dnah9	UTSW	11	66076358	missense	probably damaging	1.00
R4734:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4749:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4765:Dnah9	UTSW	11	65927726	missense	probably damaging	1.00
R4905:Dnah9	UTSW	11	65874124	nonsense	probably null
R4963:Dnah9	UTSW	11	66084611	splice site	probably null
R5074:Dnah9	UTSW	11	65850040	missense	probably damaging	1.00
R5230:Dnah9	UTSW	11	66084666	missense	probably damaging	0.99
R5262:Dnah9	UTSW	11	66112333	missense	probably benign	0.34
R5364:Dnah9	UTSW	11	65881696	missense	possibly damaging	0.93
R5370:Dnah9	UTSW	11	66029354	missense	probably damaging	1.00
R5386:Dnah9	UTSW	11	66029356	missense	probably damaging	1.00
R5389:Dnah9	UTSW	11	66095314	nonsense	probably null
R5541:Dnah9	UTSW	11	66145336	missense	probably damaging	1.00
R5560:Dnah9	UTSW	11	65881740	missense	probably benign	0.00
R5576:Dnah9	UTSW	11	65834096	splice site	probably null
R5648:Dnah9	UTSW	11	65927755	missense	probably benign	0.00
R5653:Dnah9	UTSW	11	65849980	missense	probably damaging	0.99
R5713:Dnah9	UTSW	11	66025223	missense	possibly damaging	0.92
R5763:Dnah9	UTSW	11	65955239	missense	probably damaging	1.00
R5825:Dnah9	UTSW	11	66126601	missense	probably benign	0.01
R5831:Dnah9	UTSW	11	66108121	missense	probably benign	0.00
R5847:Dnah9	UTSW	11	66095240	frame shift	probably null
R5870:Dnah9	UTSW	11	66085210	missense	probably benign	0.01
R5902:Dnah9	UTSW	11	66025187	missense	probably benign	0.08
R5918:Dnah9	UTSW	11	65834199	missense	probably damaging	1.00
R5979:Dnah9	UTSW	11	65834481	missense	probably damaging	1.00
R6065:Dnah9	UTSW	11	65855338	missense	probably benign	0.05
R6065:Dnah9	UTSW	11	66145397	missense	possibly damaging	0.65
R6086:Dnah9	UTSW	11	65989915	missense	probably damaging	0.99
R6086:Dnah9	UTSW	11	66085174	missense	probably benign
R6102:Dnah9	UTSW	11	65990516	missense	probably damaging	0.97
R6120:Dnah9	UTSW	11	66147399	missense	probably benign
R6154:Dnah9	UTSW	11	65855338	missense	probably benign	0.00
R6262:Dnah9	UTSW	11	65881805	splice site	probably null
R6265:Dnah9	UTSW	11	66168094	missense	probably benign	0.04
R6290:Dnah9	UTSW	11	65841375	missense	probably damaging	1.00
R6345:Dnah9	UTSW	11	66037693	missense	probably damaging	0.97
R6357:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
R6534:Dnah9	UTSW	11	65955248	missense	probably damaging	0.99
R6574:Dnah9	UTSW	11	66168281	missense	probably benign	0.37
R6582:Dnah9	UTSW	11	66061097	missense	probably damaging	1.00
R6700:Dnah9	UTSW	11	65955366	missense	probably damaging	1.00
R6800:Dnah9	UTSW	11	66072739	critical splice donor site	probably null
R6812:Dnah9	UTSW	11	65981329	missense	probably damaging	0.99
R6931:Dnah9	UTSW	11	66117626	missense	possibly damaging	0.63
R6944:Dnah9	UTSW	11	66085149	missense	possibly damaging	0.91
R6958:Dnah9	UTSW	11	66076341	missense	probably damaging	1.00
R6977:Dnah9	UTSW	11	66107909	missense	probably benign	0.37
R7021:Dnah9	UTSW	11	65981231	missense	probably benign
R7161:Dnah9	UTSW	11	65855372	nonsense	probably null
R7175:Dnah9	UTSW	11	66133637	missense	probably benign	0.03
R7199:Dnah9	UTSW	11	66118944	missense	probably benign	0.04
R7231:Dnah9	UTSW	11	65965647	missense	probably damaging	1.00
R7284:Dnah9	UTSW	11	65990476	missense	probably damaging	0.99
R7314:Dnah9	UTSW	11	65989851	missense	probably benign	0.00
R7350:Dnah9	UTSW	11	66080578	missense	probably damaging	1.00
R7420:Dnah9	UTSW	11	66117407	critical splice donor site	probably null
R7427:Dnah9	UTSW	11	65955219	missense	probably benign
R7477:Dnah9	UTSW	11	65992731	missense	probably damaging	0.98
R7515:Dnah9	UTSW	11	65841414	missense	probably benign	0.01
R7521:Dnah9	UTSW	11	65989837	missense	probably damaging	0.98
R7573:Dnah9	UTSW	11	66125215	missense	probably benign	0.43
R7659:Dnah9	UTSW	11	65989780	missense	probably damaging	0.99
R7707:Dnah9	UTSW	11	66118958	missense	probably damaging	1.00
R7749:Dnah9	UTSW	11	65911830	missense	probably damaging	1.00
R7792:Dnah9	UTSW	11	65850013	missense	probably damaging	1.00
R7808:Dnah9	UTSW	11	66005805	nonsense	probably null
R7814:Dnah9	UTSW	11	66005660	missense	probably damaging	1.00
R7818:Dnah9	UTSW	11	66025211	missense	possibly damaging	0.64
R7890:Dnah9	UTSW	11	66072072	missense	probably damaging	0.99
R7976:Dnah9	UTSW	11	65841401	missense	possibly damaging	0.91
R8121:Dnah9	UTSW	11	66017375	missense	probably benign	0.02
R8232:Dnah9	UTSW	11	65855323	missense	possibly damaging	0.91
R8311:Dnah9	UTSW	11	65989818	missense	probably benign	0.00
R8326:Dnah9	UTSW	11	66117626	missense	probably benign	0.01
R8338:Dnah9	UTSW	11	65841241	critical splice donor site	probably null
R8356:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8456:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8468:Dnah9	UTSW	11	65831730	missense	probably benign	0.00
R8721:Dnah9	UTSW	11	66095298	missense	probably damaging	1.00
R8747:Dnah9	UTSW	11	65927990	missense	possibly damaging	0.69
R8798:Dnah9	UTSW	11	65905231	missense	probably damaging	0.99
R8806:Dnah9	UTSW	11	65859483	missense	probably damaging	1.00
R8826:Dnah9	UTSW	11	65849916	missense	probably benign	0.13
R8837:Dnah9	UTSW	11	65855234	missense	possibly damaging	0.72
R8886:Dnah9	UTSW	11	66053014	missense	probably damaging	1.00
R8887:Dnah9	UTSW	11	65855384	missense	probably benign	0.01
R8921:Dnah9	UTSW	11	65911921	missense	probably benign
R8933:Dnah9	UTSW	11	65855252	missense	possibly damaging	0.88
R8949:Dnah9	UTSW	11	66168400	missense	possibly damaging	0.91
R8967:Dnah9	UTSW	11	66125112	critical splice donor site	probably null
R8979:Dnah9	UTSW	11	66005152	missense	probably benign
R8991:Dnah9	UTSW	11	65886680	missense	probably damaging	0.96
R9016:Dnah9	UTSW	11	66108030	missense	probably damaging	0.99
R9025:Dnah9	UTSW	11	66005825	missense	probably damaging	1.00
R9043:Dnah9	UTSW	11	65954854	missense
R9047:Dnah9	UTSW	11	66072099	missense	possibly damaging	0.89
R9076:Dnah9	UTSW	11	66117638	missense	probably benign	0.21
R9113:Dnah9	UTSW	11	65989887	missense	probably damaging	1.00
R9152:Dnah9	UTSW	11	66130631	missense	probably damaging	1.00
R9187:Dnah9	UTSW	11	66005146	missense	probably benign
R9198:Dnah9	UTSW	11	65955744	missense	probably benign	0.02
R9203:Dnah9	UTSW	11	65855287	missense	possibly damaging	0.58
R9234:Dnah9	UTSW	11	66033925	missense	possibly damaging	0.68
R9245:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R9265:Dnah9	UTSW	11	65841255	missense	probably benign	0.01
R9307:Dnah9	UTSW	11	66085474	missense	probably benign	0.14
R9336:Dnah9	UTSW	11	65870949	missense	probably damaging	1.00
R9386:Dnah9	UTSW	11	65947542	missense	probably damaging	1.00
R9498:Dnah9	UTSW	11	65848373	missense	probably damaging	0.99
R9508:Dnah9	UTSW	11	65834263	missense	probably damaging	1.00
R9524:Dnah9	UTSW	11	66085483	missense	possibly damaging	0.92
R9577:Dnah9	UTSW	11	65976521	missense	probably benign	0.00
R9583:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R9587:Dnah9	UTSW	11	66108391	missense	probably null	0.92
R9612:Dnah9	UTSW	11	65927649	missense	probably benign	0.00
R9748:Dnah9	UTSW	11	66085464	missense	possibly damaging	0.51
R9749:Dnah9	UTSW	11	66095376	missense	probably damaging	1.00
R9759:Dnah9	UTSW	11	66075118	missense	probably null	0.93
R9784:Dnah9	UTSW	11	66085134	missense	probably damaging	0.99
V3553:Dnah9	UTSW	11	65970076	missense	probably damaging	1.00
X0027:Dnah9	UTSW	11	66085479	missense	probably benign	0.07
X0028:Dnah9	UTSW	11	65990452	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65895972	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65927853	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65970084	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66037474	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66072835	missense	probably damaging	1.00
Z1177:Dnah9	UTSW	11	66126650	missense	probably damaging	1.00
Z1186:Dnah9	UTSW	11	66085174	missense	probably benign
Z1186:Dnah9	UTSW	11	66147381	missense	probably benign
Z1187:Dnah9	UTSW	11	66085174	missense	probably benign
Z1187:Dnah9	UTSW	11	66147381	missense	probably benign
Z1188:Dnah9	UTSW	11	66085174	missense	probably benign
Z1188:Dnah9	UTSW	11	66147381	missense	probably benign
Z1189:Dnah9	UTSW	11	66085174	missense	probably benign
Z1189:Dnah9	UTSW	11	66147381	missense	probably benign
Z1190:Dnah9	UTSW	11	66085174	missense	probably benign
Z1190:Dnah9	UTSW	11	66147381	missense	probably benign
Z1191:Dnah9	UTSW	11	66085174	missense	probably benign
Z1191:Dnah9	UTSW	11	66147381	missense	probably benign
Z1192:Dnah9	UTSW	11	66085174	missense	probably benign
Z1192:Dnah9	UTSW	11	66147381	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTTTGCTCTTGGATGGATTTAAAG -3'
(R):5'- TAGATGTGGTCCCAGAGTCC -3'

Sequencing Primer
(F):5'- TTGGATGGATTTAAAGAAAAAGGCTC -3'
(R):5'- CTGGCAGCCTGGTTTCTAGAC -3'

Posted On

2014-06-23