Mutagenetix > Incidental Mutation

Incidental Mutation 'R1840:Ints2'

205734

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

039866-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1840 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86233085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 626 (G626R)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000018212
AA Change: G626R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: G626R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108039
AA Change: G626R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: G626R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127745

Predicted Effect

probably benign
Transcript: ENSMUST00000134828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146421

Meta Mutation Damage Score

0.3327

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 95.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029I15Rik	T	C	2: 92,383,209	S36P	probably benign	Het
2510009E07Rik	T	A	16: 21,653,486	M85L	probably benign	Het
Aatk	T	G	11: 120,013,732	D206A	probably damaging	Het
Agap3	A	G	5: 24,500,231	D719G	probably damaging	Het
Agrn	G	A	4: 156,167,415	R1797C	probably damaging	Het
Ascc3	T	A	10: 50,690,161	M734K	probably benign	Het
Asph	T	A	4: 9,601,340	M136L	possibly damaging	Het
Atm	A	T	9: 53,456,530	V2431E	probably damaging	Het
Atp2b1	A	G	10: 99,022,929	H1158R	probably benign	Het
Atxn7l1	A	G	12: 33,371,033		probably null	Het
BC024139	G	T	15: 76,120,642	S611R	probably benign	Het
Becn1	C	T	11: 101,295,566	G105S	probably damaging	Het
Bud13	A	G	9: 46,286,408	E70G	probably damaging	Het
Cacul1	A	T	19: 60,534,250	L282*	probably null	Het
Ccar1	T	A	10: 62,763,510	K614M	probably damaging	Het
Cd96	T	C	16: 46,099,092	T189A	probably benign	Het
Cdh5	C	A	8: 104,126,616	Y189*	probably null	Het
Chka	A	G	19: 3,886,460	N284S	probably benign	Het
Cntn6	A	T	6: 104,774,480	I366F	probably damaging	Het
Csmd3	C	T	15: 47,607,164	G3372E	probably damaging	Het
Cyp4f16	T	C	17: 32,543,006		probably null	Het
Dcaf6	A	G	1: 165,399,748	V270A	probably damaging	Het
Ddx60	T	A	8: 61,969,553	I608N	probably damaging	Het
Dnah9	A	T	11: 65,834,198	C1849*	probably null	Het
Eci3	C	A	13: 34,960,041	V34L	probably benign	Het
Epha1	C	T	6: 42,363,588	R583H	probably damaging	Het
Erbin	A	T	13: 103,834,947	N720K	probably benign	Het
Eya1	T	A	1: 14,229,504	R346*	probably null	Het
Fam189a1	C	A	7: 64,759,195	V484L	probably benign	Het
Fhdc1	G	A	3: 84,445,821	T699I	possibly damaging	Het
Flvcr2	T	C	12: 85,803,221	V427A	possibly damaging	Het
Fzd9	T	A	5: 135,249,571	T487S	probably benign	Het
Gas2l3	T	C	10: 89,422,251	Y160C	possibly damaging	Het
Gm10264	T	C	12: 88,329,411	V53A	probably benign	Het
Gm10269	T	C	18: 20,682,809	K52R	probably damaging	Het
Gm16432	A	G	1: 178,003,015	D30G	possibly damaging	Het
Gm8674	A	T	13: 49,901,765		noncoding transcript	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Gramd4	T	C	15: 86,130,192		probably null	Het
Gtpbp4	A	G	13: 8,979,464	L403P	probably benign	Het
H6pd	A	T	4: 149,982,050	D626E	possibly damaging	Het
Herc6	T	A	6: 57,658,106	L769*	probably null	Het
Hes5	A	G	4: 154,961,254	K58R	probably damaging	Het
Heyl	A	G	4: 123,241,390	I59V	probably damaging	Het
Hpca	A	G	4: 129,118,600	F48L	probably damaging	Het
Ice1	C	T	13: 70,606,218	R583Q	probably benign	Het
Kansl1l	T	A	1: 66,778,032	I390F	probably damaging	Het
Kat5	C	T	19: 5,609,238	V95M	possibly damaging	Het
Kcnh4	T	A	11: 100,745,341	I827F	possibly damaging	Het
Kif1b	C	T	4: 149,188,132	R138Q	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lats1	T	A	10: 7,710,939	L955*	probably null	Het
Ldlrad2	A	C	4: 137,572,184	C110G	possibly damaging	Het
Lgi3	G	A	14: 70,534,776		probably null	Het
Lingo1	A	G	9: 56,620,558	M249T	probably benign	Het
Lrig3	A	T	10: 126,013,389	R993*	probably null	Het
Lsm14b	T	A	2: 180,026,728	I74N	probably damaging	Het
Lyplal1	T	A	1: 186,100,217	I114F	probably damaging	Het
Mmp15	A	G	8: 95,365,420	Y86C	probably damaging	Het
Myh2	A	G	11: 67,186,487	E816G	probably benign	Het
Myo5c	A	G	9: 75,249,735	N151S	probably damaging	Het
Nckap1	T	A	2: 80,502,250	E1082V	possibly damaging	Het
Nrg4	A	C	9: 55,282,606		probably benign	Het
Nrp2	T	C	1: 62,738,339	L101P	probably damaging	Het
Olfr1180	T	C	2: 88,412,067	D197G	probably benign	Het
Olfr126	A	T	17: 37,850,748	D52V	probably damaging	Het
Olfr521	A	T	7: 99,767,596	T145S	probably benign	Het
Olfr638	A	G	7: 104,004,117	I281V	probably benign	Het
Olfr992	G	A	2: 85,400,168	R122C	probably benign	Het
Parp14	T	A	16: 35,863,449	E169V	probably damaging	Het
Pcolce2	G	A	9: 95,670,117	R101H	probably damaging	Het
Pcolce2	A	T	9: 95,670,203	N130Y	probably benign	Het
Plscr1	A	T	9: 92,258,074	S5C	unknown	Het
Plxdc2	T	C	2: 16,669,856	V338A	probably benign	Het
Psg23	T	A	7: 18,610,438	N364I	possibly damaging	Het
Psmg4	A	G	13: 34,178,056	E109G	probably damaging	Het
Ptk2	T	C	15: 73,210,884	E908G	probably damaging	Het
Ptpn14	G	A	1: 189,786,851	R26H	probably damaging	Het
Ranbp2	T	A	10: 58,478,766	N1769K	probably benign	Het
Rbm14	C	T	19: 4,801,795		probably benign	Het
Rgs7	A	T	1: 175,153,148	D103E	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Rock2	T	A	12: 16,928,989	D93E	probably benign	Het
Rps6ka6	A	G	X: 111,420,932	I246T	possibly damaging	Het
Rubcn	T	C	16: 32,826,172	M803V	possibly damaging	Het
Ryr3	T	C	2: 112,750,820	Y2889C	probably damaging	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Selplg	T	C	5: 113,819,844	T134A	possibly damaging	Het
Sez6	C	A	11: 77,953,717	T122N	possibly damaging	Het
Slc9b1	T	A	3: 135,357,468	D4E	unknown	Het
Smim18	A	G	8: 33,742,348	M81T	probably benign	Het
Snap91	A	T	9: 86,815,465	H281Q	probably damaging	Het
Sparc	C	A	11: 55,395,866	C302F	probably damaging	Het
Spg11	A	G	2: 122,101,756	L535P	probably damaging	Het
Spsb1	G	A	4: 149,906,631	T160I	probably damaging	Het
Stra6	A	G	9: 58,140,530	N128S	probably benign	Het
Strc	T	C	2: 121,379,296	E182G	probably damaging	Het
Sult2a6	A	G	7: 14,254,829	M2T	probably benign	Het
Sv2c	T	C	13: 95,981,844	N499S	probably benign	Het
Szt2	A	T	4: 118,365,657		probably benign	Het
Tbx20	A	T	9: 24,725,676	S372T	probably benign	Het
Tcp11l2	T	A	10: 84,604,599	S289T	probably damaging	Het
Tdrd1	A	G	19: 56,842,312	E259G	probably damaging	Het
Thsd7a	T	A	6: 12,330,974	I1390L	probably benign	Het
Tln2	G	A	9: 67,342,043	R921W	probably damaging	Het
Tmem126a	C	A	7: 90,452,884	G36*	probably null	Het
Tmem245	C	T	4: 56,903,947	V606I	probably benign	Het
Trpm6	A	G	19: 18,866,267	D1665G	probably benign	Het
Ubac2	T	G	14: 121,994,262	V200G	probably benign	Het
Ubr5	G	A	15: 37,980,917	A2372V	possibly damaging	Het
Ugcg	C	T	4: 59,219,517	P285S	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r118	T	A	17: 55,610,406	K369*	probably null	Het
Xpnpep3	G	T	15: 81,427,353	A87S	probably benign	Het
Zc3h7a	C	T	16: 11,161,026	R95H	probably damaging	Het
Zdhhc11	A	G	13: 73,974,652	N169S	probably damaging	Het
Zfp62	T	A	11: 49,216,388	D435E	probably damaging	Het
Zfyve16	T	C	13: 92,511,525	D1007G	possibly damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGGCTTCAAAACAACTCCTTG -3'
(R):5'- TAGGACTGGATTTACAGACAGC -3'

Sequencing Primer
(F):5'- ATGAGTTTGCGACTACCCAG -3'
(R):5'- GACTGGATTTACAGACAGCTATGTG -3'

Posted On

2014-06-23