Incidental Mutation 'R1840:Aatk'
ID205738
Institutional Source Beutler Lab
Gene Symbol Aatk
Ensembl Gene ENSMUSG00000025375
Gene Nameapoptosis-associated tyrosine kinase
SynonymsAATYK1
MMRRC Submission 039866-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R1840 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120007313-120047167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 120013732 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 206 (D206A)
Ref Sequence ENSEMBL: ENSMUSP00000099309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064307] [ENSMUST00000103019] [ENSMUST00000103020]
Predicted Effect probably damaging
Transcript: ENSMUST00000064307
AA Change: D263A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067181
Gene: ENSMUSG00000025375
AA Change: D263A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 49 N/A INTRINSIC
Pfam:Pkinase_Tyr 135 405 3.9e-63 PFAM
Pfam:Pkinase 136 404 2.6e-33 PFAM
low complexity region 425 457 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 615 624 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
low complexity region 808 819 N/A INTRINSIC
low complexity region 913 927 N/A INTRINSIC
low complexity region 934 943 N/A INTRINSIC
low complexity region 985 1004 N/A INTRINSIC
low complexity region 1063 1082 N/A INTRINSIC
low complexity region 1085 1096 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
low complexity region 1179 1204 N/A INTRINSIC
low complexity region 1319 1333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083666
Predicted Effect probably damaging
Transcript: ENSMUST00000103019
AA Change: D206A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099308
Gene: ENSMUSG00000025375
AA Change: D206A

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103020
AA Change: D206A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099309
Gene: ENSMUSG00000025375
AA Change: D206A

DomainStartEndE-ValueType
Pfam:Pkinase 78 347 3e-36 PFAM
Pfam:Pkinase_Tyr 78 348 1.9e-62 PFAM
low complexity region 368 400 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
low complexity region 590 609 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 751 762 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
low complexity region 928 947 N/A INTRINSIC
low complexity region 1006 1025 N/A INTRINSIC
low complexity region 1028 1039 N/A INTRINSIC
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1122 1147 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198674
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a tyrosine kinase domain at the N-terminus and a proline-rich domain at the C-terminus. This gene is induced during apoptosis, and expression of this gene may be a necessary pre-requisite for the induction of growth arrest and/or apoptosis of myeloid precursor cells. This gene has been shown to produce neuronal differentiation in a neuroblastoma cell line. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased brain size, longer axons and fewer neurites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik T C 2: 92,383,209 S36P probably benign Het
2510009E07Rik T A 16: 21,653,486 M85L probably benign Het
Agap3 A G 5: 24,500,231 D719G probably damaging Het
Agrn G A 4: 156,167,415 R1797C probably damaging Het
Ascc3 T A 10: 50,690,161 M734K probably benign Het
Asph T A 4: 9,601,340 M136L possibly damaging Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atp2b1 A G 10: 99,022,929 H1158R probably benign Het
Atxn7l1 A G 12: 33,371,033 probably null Het
BC024139 G T 15: 76,120,642 S611R probably benign Het
Becn1 C T 11: 101,295,566 G105S probably damaging Het
Bud13 A G 9: 46,286,408 E70G probably damaging Het
Cacul1 A T 19: 60,534,250 L282* probably null Het
Ccar1 T A 10: 62,763,510 K614M probably damaging Het
Cd96 T C 16: 46,099,092 T189A probably benign Het
Cdh5 C A 8: 104,126,616 Y189* probably null Het
Chka A G 19: 3,886,460 N284S probably benign Het
Cntn6 A T 6: 104,774,480 I366F probably damaging Het
Csmd3 C T 15: 47,607,164 G3372E probably damaging Het
Cyp4f16 T C 17: 32,543,006 probably null Het
Dcaf6 A G 1: 165,399,748 V270A probably damaging Het
Ddx60 T A 8: 61,969,553 I608N probably damaging Het
Dnah9 A T 11: 65,834,198 C1849* probably null Het
Eci3 C A 13: 34,960,041 V34L probably benign Het
Epha1 C T 6: 42,363,588 R583H probably damaging Het
Erbin A T 13: 103,834,947 N720K probably benign Het
Eya1 T A 1: 14,229,504 R346* probably null Het
Fam189a1 C A 7: 64,759,195 V484L probably benign Het
Fhdc1 G A 3: 84,445,821 T699I possibly damaging Het
Flvcr2 T C 12: 85,803,221 V427A possibly damaging Het
Fzd9 T A 5: 135,249,571 T487S probably benign Het
Gas2l3 T C 10: 89,422,251 Y160C possibly damaging Het
Gm10264 T C 12: 88,329,411 V53A probably benign Het
Gm10269 T C 18: 20,682,809 K52R probably damaging Het
Gm16432 A G 1: 178,003,015 D30G possibly damaging Het
Gm8674 A T 13: 49,901,765 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Gramd4 T C 15: 86,130,192 probably null Het
Gtpbp4 A G 13: 8,979,464 L403P probably benign Het
H6pd A T 4: 149,982,050 D626E possibly damaging Het
Herc6 T A 6: 57,658,106 L769* probably null Het
Hes5 A G 4: 154,961,254 K58R probably damaging Het
Heyl A G 4: 123,241,390 I59V probably damaging Het
Hpca A G 4: 129,118,600 F48L probably damaging Het
Ice1 C T 13: 70,606,218 R583Q probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kansl1l T A 1: 66,778,032 I390F probably damaging Het
Kat5 C T 19: 5,609,238 V95M possibly damaging Het
Kcnh4 T A 11: 100,745,341 I827F possibly damaging Het
Kif1b C T 4: 149,188,132 R138Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lats1 T A 10: 7,710,939 L955* probably null Het
Ldlrad2 A C 4: 137,572,184 C110G possibly damaging Het
Lgi3 G A 14: 70,534,776 probably null Het
Lingo1 A G 9: 56,620,558 M249T probably benign Het
Lrig3 A T 10: 126,013,389 R993* probably null Het
Lsm14b T A 2: 180,026,728 I74N probably damaging Het
Lyplal1 T A 1: 186,100,217 I114F probably damaging Het
Mmp15 A G 8: 95,365,420 Y86C probably damaging Het
Myh2 A G 11: 67,186,487 E816G probably benign Het
Myo5c A G 9: 75,249,735 N151S probably damaging Het
Nckap1 T A 2: 80,502,250 E1082V possibly damaging Het
Nrg4 A C 9: 55,282,606 probably benign Het
Nrp2 T C 1: 62,738,339 L101P probably damaging Het
Olfr1180 T C 2: 88,412,067 D197G probably benign Het
Olfr126 A T 17: 37,850,748 D52V probably damaging Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr638 A G 7: 104,004,117 I281V probably benign Het
Olfr992 G A 2: 85,400,168 R122C probably benign Het
Parp14 T A 16: 35,863,449 E169V probably damaging Het
Pcolce2 G A 9: 95,670,117 R101H probably damaging Het
Pcolce2 A T 9: 95,670,203 N130Y probably benign Het
Plscr1 A T 9: 92,258,074 S5C unknown Het
Plxdc2 T C 2: 16,669,856 V338A probably benign Het
Psg23 T A 7: 18,610,438 N364I possibly damaging Het
Psmg4 A G 13: 34,178,056 E109G probably damaging Het
Ptk2 T C 15: 73,210,884 E908G probably damaging Het
Ptpn14 G A 1: 189,786,851 R26H probably damaging Het
Ranbp2 T A 10: 58,478,766 N1769K probably benign Het
Rbm14 C T 19: 4,801,795 probably benign Het
Rgs7 A T 1: 175,153,148 D103E probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rock2 T A 12: 16,928,989 D93E probably benign Het
Rps6ka6 A G X: 111,420,932 I246T possibly damaging Het
Rubcn T C 16: 32,826,172 M803V possibly damaging Het
Ryr3 T C 2: 112,750,820 Y2889C probably damaging Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Selplg T C 5: 113,819,844 T134A possibly damaging Het
Sez6 C A 11: 77,953,717 T122N possibly damaging Het
Slc9b1 T A 3: 135,357,468 D4E unknown Het
Smim18 A G 8: 33,742,348 M81T probably benign Het
Snap91 A T 9: 86,815,465 H281Q probably damaging Het
Sparc C A 11: 55,395,866 C302F probably damaging Het
Spg11 A G 2: 122,101,756 L535P probably damaging Het
Spsb1 G A 4: 149,906,631 T160I probably damaging Het
Stra6 A G 9: 58,140,530 N128S probably benign Het
Strc T C 2: 121,379,296 E182G probably damaging Het
Sult2a6 A G 7: 14,254,829 M2T probably benign Het
Sv2c T C 13: 95,981,844 N499S probably benign Het
Szt2 A T 4: 118,365,657 probably benign Het
Tbx20 A T 9: 24,725,676 S372T probably benign Het
Tcp11l2 T A 10: 84,604,599 S289T probably damaging Het
Tdrd1 A G 19: 56,842,312 E259G probably damaging Het
Thsd7a T A 6: 12,330,974 I1390L probably benign Het
Tln2 G A 9: 67,342,043 R921W probably damaging Het
Tmem126a C A 7: 90,452,884 G36* probably null Het
Tmem245 C T 4: 56,903,947 V606I probably benign Het
Trpm6 A G 19: 18,866,267 D1665G probably benign Het
Ubac2 T G 14: 121,994,262 V200G probably benign Het
Ubr5 G A 15: 37,980,917 A2372V possibly damaging Het
Ugcg C T 4: 59,219,517 P285S probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r118 T A 17: 55,610,406 K369* probably null Het
Xpnpep3 G T 15: 81,427,353 A87S probably benign Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zdhhc11 A G 13: 73,974,652 N169S probably damaging Het
Zfp62 T A 11: 49,216,388 D435E probably damaging Het
Zfyve16 T C 13: 92,511,525 D1007G possibly damaging Het
Other mutations in Aatk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Aatk APN 11 120010186 missense probably benign 0.02
IGL00953:Aatk APN 11 120011221 missense probably benign 0.00
IGL01019:Aatk APN 11 120012275 missense probably benign
IGL01758:Aatk APN 11 120010819 missense possibly damaging 0.86
IGL02377:Aatk APN 11 120046863 utr 5 prime probably benign
IGL02902:Aatk APN 11 120011777 missense probably benign 0.00
IGL03067:Aatk APN 11 120010083 missense probably benign 0.00
IGL03116:Aatk APN 11 120016751 missense probably benign 0.14
IGL03279:Aatk APN 11 120013678 missense probably damaging 1.00
IGL03405:Aatk APN 11 120016403 missense probably benign 0.02
PIT4366001:Aatk UTSW 11 120010960 missense possibly damaging 0.55
PIT4802001:Aatk UTSW 11 120011346 missense probably benign
R0101:Aatk UTSW 11 120010913 missense probably benign 0.19
R0497:Aatk UTSW 11 120018780 missense probably damaging 0.99
R0535:Aatk UTSW 11 120010193 missense probably benign 0.00
R0638:Aatk UTSW 11 120009922 missense probably damaging 1.00
R0939:Aatk UTSW 11 120012143 missense probably damaging 0.99
R1475:Aatk UTSW 11 120010888 missense probably damaging 0.96
R1865:Aatk UTSW 11 120010222 missense probably benign 0.00
R1982:Aatk UTSW 11 120013514 missense probably damaging 1.00
R2027:Aatk UTSW 11 120009317 missense probably damaging 1.00
R2115:Aatk UTSW 11 120009736 missense probably benign
R2220:Aatk UTSW 11 120012177 missense probably damaging 1.00
R2264:Aatk UTSW 11 120010274 missense probably damaging 1.00
R2504:Aatk UTSW 11 120018855 missense probably benign 0.00
R3872:Aatk UTSW 11 120010219 missense possibly damaging 0.71
R4551:Aatk UTSW 11 120011569 missense probably benign 0.03
R4657:Aatk UTSW 11 120013478 missense possibly damaging 0.69
R4744:Aatk UTSW 11 120016122 missense possibly damaging 0.64
R4924:Aatk UTSW 11 120011525 missense probably damaging 1.00
R5063:Aatk UTSW 11 120010489 missense probably benign 0.07
R5223:Aatk UTSW 11 120013452 missense possibly damaging 0.95
R5243:Aatk UTSW 11 120016768 missense probably damaging 1.00
R5376:Aatk UTSW 11 120012034 missense probably damaging 0.98
R5442:Aatk UTSW 11 120018768 missense probably benign 0.02
R5550:Aatk UTSW 11 120009303 missense probably benign 0.42
R5678:Aatk UTSW 11 120010154 missense probably benign 0.00
R5932:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6026:Aatk UTSW 11 120012364 missense possibly damaging 0.65
R6129:Aatk UTSW 11 120021533 missense probably damaging 1.00
R6409:Aatk UTSW 11 120011732 missense probably benign 0.01
R6477:Aatk UTSW 11 120018870 missense probably benign 0.00
R6478:Aatk UTSW 11 120010991 missense probably benign 0.00
R6749:Aatk UTSW 11 120010774 missense possibly damaging 0.58
R6753:Aatk UTSW 11 120010151 missense probably benign
R6787:Aatk UTSW 11 120010682 missense probably damaging 1.00
R6852:Aatk UTSW 11 120010468 missense probably benign 0.10
R7114:Aatk UTSW 11 120009619 missense probably benign
R7557:Aatk UTSW 11 120009430 missense possibly damaging 0.73
X0064:Aatk UTSW 11 120011176 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACCACACGTTGCTGCTCTTG -3'
(R):5'- CTTCCAAAATAGCCAGTACAGGG -3'

Sequencing Primer
(F):5'- TCAGCGGTCACGAGATAGTCTTC -3'
(R):5'- CCAGTACAGGGTGTGGAGC -3'
Posted On2014-06-23