Incidental Mutation 'R1840:Vmn2r118'
ID 205772
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Name vomeronasal 2, receptor 118
Synonyms Vmn2r119, EG668547, EG383258
MMRRC Submission 039866-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R1840 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 55899341-55931672 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 55917406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 369 (K369*)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
AlphaFold E9Q1C1
Predicted Effect probably null
Transcript: ENSMUST00000168440
AA Change: K369*
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: K369*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,472,236 (GRCm39) M85L probably benign Het
Aatk T G 11: 119,904,558 (GRCm39) D206A probably damaging Het
Agap3 A G 5: 24,705,229 (GRCm39) D719G probably damaging Het
Agrn G A 4: 156,251,872 (GRCm39) R1797C probably damaging Het
Ascc3 T A 10: 50,566,257 (GRCm39) M734K probably benign Het
Asph T A 4: 9,601,340 (GRCm39) M136L possibly damaging Het
Atm A T 9: 53,367,830 (GRCm39) V2431E probably damaging Het
Atp2b1 A G 10: 98,858,791 (GRCm39) H1158R probably benign Het
Atxn7l1 A G 12: 33,421,032 (GRCm39) probably null Het
BC024139 G T 15: 76,004,842 (GRCm39) S611R probably benign Het
Becn1 C T 11: 101,186,392 (GRCm39) G105S probably damaging Het
Bud13 A G 9: 46,197,706 (GRCm39) E70G probably damaging Het
Cacul1 A T 19: 60,522,688 (GRCm39) L282* probably null Het
Catspere2 A G 1: 177,830,581 (GRCm39) D30G possibly damaging Het
Ccar1 T A 10: 62,599,289 (GRCm39) K614M probably damaging Het
Cd96 T C 16: 45,919,455 (GRCm39) T189A probably benign Het
Cdh5 C A 8: 104,853,248 (GRCm39) Y189* probably null Het
Chka A G 19: 3,936,460 (GRCm39) N284S probably benign Het
Cntn6 A T 6: 104,751,441 (GRCm39) I366F probably damaging Het
Csmd3 C T 15: 47,470,560 (GRCm39) G3372E probably damaging Het
Cyp4f16 T C 17: 32,761,980 (GRCm39) probably null Het
Dcaf6 A G 1: 165,227,317 (GRCm39) V270A probably damaging Het
Ddx60 T A 8: 62,422,587 (GRCm39) I608N probably damaging Het
Dnah9 A T 11: 65,725,024 (GRCm39) C1849* probably null Het
Eci3 C A 13: 35,144,024 (GRCm39) V34L probably benign Het
Eif1ad9 T C 12: 88,296,181 (GRCm39) V53A probably benign Het
Entrep2 C A 7: 64,408,943 (GRCm39) V484L probably benign Het
Epha1 C T 6: 42,340,522 (GRCm39) R583H probably damaging Het
Erbin A T 13: 103,971,455 (GRCm39) N720K probably benign Het
Eya1 T A 1: 14,299,728 (GRCm39) R346* probably null Het
Fhdc1 G A 3: 84,353,128 (GRCm39) T699I possibly damaging Het
Flvcr2 T C 12: 85,849,995 (GRCm39) V427A possibly damaging Het
Frey1 T C 2: 92,213,554 (GRCm39) S36P probably benign Het
Fzd9 T A 5: 135,278,425 (GRCm39) T487S probably benign Het
Gas2l3 T C 10: 89,258,113 (GRCm39) Y160C possibly damaging Het
Gm10269 T C 18: 20,815,866 (GRCm39) K52R probably damaging Het
Gm8674 A T 13: 50,055,801 (GRCm39) noncoding transcript Het
Gpr61 A G 3: 108,057,797 (GRCm39) V288A possibly damaging Het
Gramd4 T C 15: 86,014,393 (GRCm39) probably null Het
Gtpbp4 A G 13: 9,029,500 (GRCm39) L403P probably benign Het
H6pd A T 4: 150,066,507 (GRCm39) D626E possibly damaging Het
Herc6 T A 6: 57,635,091 (GRCm39) L769* probably null Het
Hes5 A G 4: 155,045,711 (GRCm39) K58R probably damaging Het
Heyl A G 4: 123,135,183 (GRCm39) I59V probably damaging Het
Hpca A G 4: 129,012,393 (GRCm39) F48L probably damaging Het
Ice1 C T 13: 70,754,337 (GRCm39) R583Q probably benign Het
Ints2 C T 11: 86,123,911 (GRCm39) G626R probably damaging Het
Kansl1l T A 1: 66,817,191 (GRCm39) I390F probably damaging Het
Kat5 C T 19: 5,659,266 (GRCm39) V95M possibly damaging Het
Kcnh4 T A 11: 100,636,167 (GRCm39) I827F possibly damaging Het
Kif1b C T 4: 149,272,589 (GRCm39) R138Q probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lats1 T A 10: 7,586,703 (GRCm39) L955* probably null Het
Ldlrad2 A C 4: 137,299,495 (GRCm39) C110G possibly damaging Het
Lgi3 G A 14: 70,772,216 (GRCm39) probably null Het
Lingo1 A G 9: 56,527,842 (GRCm39) M249T probably benign Het
Lrig3 A T 10: 125,849,258 (GRCm39) R993* probably null Het
Lsm14b T A 2: 179,668,521 (GRCm39) I74N probably damaging Het
Lyplal1 T A 1: 185,832,414 (GRCm39) I114F probably damaging Het
Mmp15 A G 8: 96,092,048 (GRCm39) Y86C probably damaging Het
Myh2 A G 11: 67,077,313 (GRCm39) E816G probably benign Het
Myo5c A G 9: 75,157,017 (GRCm39) N151S probably damaging Het
Nckap1 T A 2: 80,332,594 (GRCm39) E1082V possibly damaging Het
Nrg4 A C 9: 55,189,890 (GRCm39) probably benign Het
Nrp2 T C 1: 62,777,498 (GRCm39) L101P probably damaging Het
Or14j5 A T 17: 38,161,639 (GRCm39) D52V probably damaging Het
Or2at1 A T 7: 99,416,803 (GRCm39) T145S probably benign Het
Or4p19 T C 2: 88,242,411 (GRCm39) D197G probably benign Het
Or51q1c A G 7: 103,653,324 (GRCm39) I281V probably benign Het
Or5ak22 G A 2: 85,230,512 (GRCm39) R122C probably benign Het
Parp14 T A 16: 35,683,819 (GRCm39) E169V probably damaging Het
Pcolce2 A T 9: 95,552,256 (GRCm39) N130Y probably benign Het
Pcolce2 G A 9: 95,552,170 (GRCm39) R101H probably damaging Het
Plscr1 A T 9: 92,140,127 (GRCm39) S5C unknown Het
Plxdc2 T C 2: 16,674,667 (GRCm39) V338A probably benign Het
Psg23 T A 7: 18,344,363 (GRCm39) N364I possibly damaging Het
Psmg4 A G 13: 34,362,039 (GRCm39) E109G probably damaging Het
Ptk2 T C 15: 73,082,733 (GRCm39) E908G probably damaging Het
Ptpn14 G A 1: 189,519,048 (GRCm39) R26H probably damaging Het
Ranbp2 T A 10: 58,314,588 (GRCm39) N1769K probably benign Het
Rbm14 C T 19: 4,851,823 (GRCm39) probably benign Het
Rgs7 A T 1: 174,980,714 (GRCm39) D103E probably damaging Het
Rmnd5a G A 6: 71,375,439 (GRCm39) L80F probably benign Het
Rock2 T A 12: 16,978,990 (GRCm39) D93E probably benign Het
Rps6ka6 A G X: 110,330,629 (GRCm39) I246T possibly damaging Het
Rubcn T C 16: 32,646,542 (GRCm39) M803V possibly damaging Het
Ryr3 T C 2: 112,581,165 (GRCm39) Y2889C probably damaging Het
Sall2 T C 14: 52,551,182 (GRCm39) N671S probably damaging Het
Selplg T C 5: 113,957,905 (GRCm39) T134A possibly damaging Het
Sez6 C A 11: 77,844,543 (GRCm39) T122N possibly damaging Het
Slc9b1 T A 3: 135,063,229 (GRCm39) D4E unknown Het
Smim18 A G 8: 34,232,376 (GRCm39) M81T probably benign Het
Snap91 A T 9: 86,697,518 (GRCm39) H281Q probably damaging Het
Sparc C A 11: 55,286,692 (GRCm39) C302F probably damaging Het
Spg11 A G 2: 121,932,237 (GRCm39) L535P probably damaging Het
Spsb1 G A 4: 149,991,088 (GRCm39) T160I probably damaging Het
Stra6 A G 9: 58,047,813 (GRCm39) N128S probably benign Het
Strc T C 2: 121,209,777 (GRCm39) E182G probably damaging Het
Sult2a6 A G 7: 13,988,754 (GRCm39) M2T probably benign Het
Sv2c T C 13: 96,118,352 (GRCm39) N499S probably benign Het
Szt2 A T 4: 118,222,854 (GRCm39) probably benign Het
Tbx20 A T 9: 24,636,972 (GRCm39) S372T probably benign Het
Tcp11l2 T A 10: 84,440,463 (GRCm39) S289T probably damaging Het
Tdrd1 A G 19: 56,830,744 (GRCm39) E259G probably damaging Het
Thsd7a T A 6: 12,330,973 (GRCm39) I1390L probably benign Het
Tln2 G A 9: 67,249,325 (GRCm39) R921W probably damaging Het
Tmem126a C A 7: 90,102,092 (GRCm39) G36* probably null Het
Tmem245 C T 4: 56,903,947 (GRCm39) V606I probably benign Het
Trpm6 A G 19: 18,843,631 (GRCm39) D1665G probably benign Het
Ubac2 T G 14: 122,231,674 (GRCm39) V200G probably benign Het
Ubr5 G A 15: 37,981,161 (GRCm39) A2372V possibly damaging Het
Ugcg C T 4: 59,219,517 (GRCm39) P285S probably damaging Het
Vmn1r9 T C 6: 57,048,522 (GRCm39) V199A probably damaging Het
Xpnpep3 G T 15: 81,311,554 (GRCm39) A87S probably benign Het
Zc3h7a C T 16: 10,978,890 (GRCm39) R95H probably damaging Het
Zdhhc11 A G 13: 74,122,771 (GRCm39) N169S probably damaging Het
Zfp62 T A 11: 49,107,215 (GRCm39) D435E probably damaging Het
Zfyve16 T C 13: 92,648,033 (GRCm39) D1007G possibly damaging Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55,899,708 (GRCm39) missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55,900,204 (GRCm39) missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55,900,000 (GRCm39) missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55,915,585 (GRCm39) missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55,899,990 (GRCm39) missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55,899,619 (GRCm39) missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55,917,517 (GRCm39) missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55,931,598 (GRCm39) missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55,917,870 (GRCm39) missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55,899,655 (GRCm39) missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55,914,996 (GRCm39) missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55,915,616 (GRCm39) missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55,915,643 (GRCm39) missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55,918,021 (GRCm39) splice site probably benign
R0513:Vmn2r118 UTSW 17 55,917,970 (GRCm39) nonsense probably null
R0627:Vmn2r118 UTSW 17 55,917,772 (GRCm39) missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55,915,466 (GRCm39) missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55,915,620 (GRCm39) missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55,900,237 (GRCm39) nonsense probably null
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R1515:Vmn2r118 UTSW 17 55,917,643 (GRCm39) missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55,915,083 (GRCm39) missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55,918,530 (GRCm39) missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55,899,456 (GRCm39) missense probably damaging 1.00
R1854:Vmn2r118 UTSW 17 55,918,556 (GRCm39) missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55,899,882 (GRCm39) missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55,899,925 (GRCm39) missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55,931,650 (GRCm39) missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55,915,421 (GRCm39) missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55,917,347 (GRCm39) missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55,917,665 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55,917,860 (GRCm39) missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55,899,581 (GRCm39) missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55,899,894 (GRCm39) missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55,899,765 (GRCm39) missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55,900,103 (GRCm39) missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55,931,494 (GRCm39) missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55,899,871 (GRCm39) missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55,915,093 (GRCm39) missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55,899,996 (GRCm39) missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55,899,714 (GRCm39) missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55,899,348 (GRCm39) missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55,917,440 (GRCm39) missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R7539:Vmn2r118 UTSW 17 55,899,853 (GRCm39) missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55,900,242 (GRCm39) missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55,915,484 (GRCm39) missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55,917,936 (GRCm39) missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55,917,423 (GRCm39) missense possibly damaging 0.94
R8415:Vmn2r118 UTSW 17 55,915,057 (GRCm39) missense probably benign 0.08
R8428:Vmn2r118 UTSW 17 55,915,642 (GRCm39) missense probably benign 0.33
R8917:Vmn2r118 UTSW 17 55,917,216 (GRCm39) missense possibly damaging 0.82
R8993:Vmn2r118 UTSW 17 55,917,835 (GRCm39) missense possibly damaging 0.72
R9038:Vmn2r118 UTSW 17 55,918,649 (GRCm39) missense probably damaging 1.00
R9155:Vmn2r118 UTSW 17 55,917,207 (GRCm39) missense probably null 0.83
R9603:Vmn2r118 UTSW 17 55,899,837 (GRCm39) missense probably damaging 1.00
R9742:Vmn2r118 UTSW 17 55,918,009 (GRCm39) missense probably damaging 0.98
R9749:Vmn2r118 UTSW 17 55,915,415 (GRCm39) critical splice donor site probably null
R9792:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9793:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9795:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
X0022:Vmn2r118 UTSW 17 55,900,218 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55,917,655 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCCTGCATTAGTTGGGTCAC -3'
(R):5'- ACCTCACAATGGGATGCCATC -3'

Sequencing Primer
(F):5'- CATTAGTTGGGTCACATTTTCCAG -3'
(R):5'- GGGAGAAAGACTTCAGCCTTACTTC -3'
Posted On 2014-06-23