Incidental Mutation 'R1840:Trpm6'
ID 205779
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 039866-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1840 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 18727347-18869875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18843631 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1665 (D1665G)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: D1665G

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: D1665G

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,472,236 (GRCm39) M85L probably benign Het
Aatk T G 11: 119,904,558 (GRCm39) D206A probably damaging Het
Agap3 A G 5: 24,705,229 (GRCm39) D719G probably damaging Het
Agrn G A 4: 156,251,872 (GRCm39) R1797C probably damaging Het
Ascc3 T A 10: 50,566,257 (GRCm39) M734K probably benign Het
Asph T A 4: 9,601,340 (GRCm39) M136L possibly damaging Het
Atm A T 9: 53,367,830 (GRCm39) V2431E probably damaging Het
Atp2b1 A G 10: 98,858,791 (GRCm39) H1158R probably benign Het
Atxn7l1 A G 12: 33,421,032 (GRCm39) probably null Het
BC024139 G T 15: 76,004,842 (GRCm39) S611R probably benign Het
Becn1 C T 11: 101,186,392 (GRCm39) G105S probably damaging Het
Bud13 A G 9: 46,197,706 (GRCm39) E70G probably damaging Het
Cacul1 A T 19: 60,522,688 (GRCm39) L282* probably null Het
Catspere2 A G 1: 177,830,581 (GRCm39) D30G possibly damaging Het
Ccar1 T A 10: 62,599,289 (GRCm39) K614M probably damaging Het
Cd96 T C 16: 45,919,455 (GRCm39) T189A probably benign Het
Cdh5 C A 8: 104,853,248 (GRCm39) Y189* probably null Het
Chka A G 19: 3,936,460 (GRCm39) N284S probably benign Het
Cntn6 A T 6: 104,751,441 (GRCm39) I366F probably damaging Het
Csmd3 C T 15: 47,470,560 (GRCm39) G3372E probably damaging Het
Cyp4f16 T C 17: 32,761,980 (GRCm39) probably null Het
Dcaf6 A G 1: 165,227,317 (GRCm39) V270A probably damaging Het
Ddx60 T A 8: 62,422,587 (GRCm39) I608N probably damaging Het
Dnah9 A T 11: 65,725,024 (GRCm39) C1849* probably null Het
Eci3 C A 13: 35,144,024 (GRCm39) V34L probably benign Het
Eif1ad9 T C 12: 88,296,181 (GRCm39) V53A probably benign Het
Entrep2 C A 7: 64,408,943 (GRCm39) V484L probably benign Het
Epha1 C T 6: 42,340,522 (GRCm39) R583H probably damaging Het
Erbin A T 13: 103,971,455 (GRCm39) N720K probably benign Het
Eya1 T A 1: 14,299,728 (GRCm39) R346* probably null Het
Fhdc1 G A 3: 84,353,128 (GRCm39) T699I possibly damaging Het
Flvcr2 T C 12: 85,849,995 (GRCm39) V427A possibly damaging Het
Frey1 T C 2: 92,213,554 (GRCm39) S36P probably benign Het
Fzd9 T A 5: 135,278,425 (GRCm39) T487S probably benign Het
Gas2l3 T C 10: 89,258,113 (GRCm39) Y160C possibly damaging Het
Gm10269 T C 18: 20,815,866 (GRCm39) K52R probably damaging Het
Gm8674 A T 13: 50,055,801 (GRCm39) noncoding transcript Het
Gpr61 A G 3: 108,057,797 (GRCm39) V288A possibly damaging Het
Gramd4 T C 15: 86,014,393 (GRCm39) probably null Het
Gtpbp4 A G 13: 9,029,500 (GRCm39) L403P probably benign Het
H6pd A T 4: 150,066,507 (GRCm39) D626E possibly damaging Het
Herc6 T A 6: 57,635,091 (GRCm39) L769* probably null Het
Hes5 A G 4: 155,045,711 (GRCm39) K58R probably damaging Het
Heyl A G 4: 123,135,183 (GRCm39) I59V probably damaging Het
Hpca A G 4: 129,012,393 (GRCm39) F48L probably damaging Het
Ice1 C T 13: 70,754,337 (GRCm39) R583Q probably benign Het
Ints2 C T 11: 86,123,911 (GRCm39) G626R probably damaging Het
Kansl1l T A 1: 66,817,191 (GRCm39) I390F probably damaging Het
Kat5 C T 19: 5,659,266 (GRCm39) V95M possibly damaging Het
Kcnh4 T A 11: 100,636,167 (GRCm39) I827F possibly damaging Het
Kif1b C T 4: 149,272,589 (GRCm39) R138Q probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lats1 T A 10: 7,586,703 (GRCm39) L955* probably null Het
Ldlrad2 A C 4: 137,299,495 (GRCm39) C110G possibly damaging Het
Lgi3 G A 14: 70,772,216 (GRCm39) probably null Het
Lingo1 A G 9: 56,527,842 (GRCm39) M249T probably benign Het
Lrig3 A T 10: 125,849,258 (GRCm39) R993* probably null Het
Lsm14b T A 2: 179,668,521 (GRCm39) I74N probably damaging Het
Lyplal1 T A 1: 185,832,414 (GRCm39) I114F probably damaging Het
Mmp15 A G 8: 96,092,048 (GRCm39) Y86C probably damaging Het
Myh2 A G 11: 67,077,313 (GRCm39) E816G probably benign Het
Myo5c A G 9: 75,157,017 (GRCm39) N151S probably damaging Het
Nckap1 T A 2: 80,332,594 (GRCm39) E1082V possibly damaging Het
Nrg4 A C 9: 55,189,890 (GRCm39) probably benign Het
Nrp2 T C 1: 62,777,498 (GRCm39) L101P probably damaging Het
Or14j5 A T 17: 38,161,639 (GRCm39) D52V probably damaging Het
Or2at1 A T 7: 99,416,803 (GRCm39) T145S probably benign Het
Or4p19 T C 2: 88,242,411 (GRCm39) D197G probably benign Het
Or51q1c A G 7: 103,653,324 (GRCm39) I281V probably benign Het
Or5ak22 G A 2: 85,230,512 (GRCm39) R122C probably benign Het
Parp14 T A 16: 35,683,819 (GRCm39) E169V probably damaging Het
Pcolce2 A T 9: 95,552,256 (GRCm39) N130Y probably benign Het
Pcolce2 G A 9: 95,552,170 (GRCm39) R101H probably damaging Het
Plscr1 A T 9: 92,140,127 (GRCm39) S5C unknown Het
Plxdc2 T C 2: 16,674,667 (GRCm39) V338A probably benign Het
Psg23 T A 7: 18,344,363 (GRCm39) N364I possibly damaging Het
Psmg4 A G 13: 34,362,039 (GRCm39) E109G probably damaging Het
Ptk2 T C 15: 73,082,733 (GRCm39) E908G probably damaging Het
Ptpn14 G A 1: 189,519,048 (GRCm39) R26H probably damaging Het
Ranbp2 T A 10: 58,314,588 (GRCm39) N1769K probably benign Het
Rbm14 C T 19: 4,851,823 (GRCm39) probably benign Het
Rgs7 A T 1: 174,980,714 (GRCm39) D103E probably damaging Het
Rmnd5a G A 6: 71,375,439 (GRCm39) L80F probably benign Het
Rock2 T A 12: 16,978,990 (GRCm39) D93E probably benign Het
Rps6ka6 A G X: 110,330,629 (GRCm39) I246T possibly damaging Het
Rubcn T C 16: 32,646,542 (GRCm39) M803V possibly damaging Het
Ryr3 T C 2: 112,581,165 (GRCm39) Y2889C probably damaging Het
Sall2 T C 14: 52,551,182 (GRCm39) N671S probably damaging Het
Selplg T C 5: 113,957,905 (GRCm39) T134A possibly damaging Het
Sez6 C A 11: 77,844,543 (GRCm39) T122N possibly damaging Het
Slc9b1 T A 3: 135,063,229 (GRCm39) D4E unknown Het
Smim18 A G 8: 34,232,376 (GRCm39) M81T probably benign Het
Snap91 A T 9: 86,697,518 (GRCm39) H281Q probably damaging Het
Sparc C A 11: 55,286,692 (GRCm39) C302F probably damaging Het
Spg11 A G 2: 121,932,237 (GRCm39) L535P probably damaging Het
Spsb1 G A 4: 149,991,088 (GRCm39) T160I probably damaging Het
Stra6 A G 9: 58,047,813 (GRCm39) N128S probably benign Het
Strc T C 2: 121,209,777 (GRCm39) E182G probably damaging Het
Sult2a6 A G 7: 13,988,754 (GRCm39) M2T probably benign Het
Sv2c T C 13: 96,118,352 (GRCm39) N499S probably benign Het
Szt2 A T 4: 118,222,854 (GRCm39) probably benign Het
Tbx20 A T 9: 24,636,972 (GRCm39) S372T probably benign Het
Tcp11l2 T A 10: 84,440,463 (GRCm39) S289T probably damaging Het
Tdrd1 A G 19: 56,830,744 (GRCm39) E259G probably damaging Het
Thsd7a T A 6: 12,330,973 (GRCm39) I1390L probably benign Het
Tln2 G A 9: 67,249,325 (GRCm39) R921W probably damaging Het
Tmem126a C A 7: 90,102,092 (GRCm39) G36* probably null Het
Tmem245 C T 4: 56,903,947 (GRCm39) V606I probably benign Het
Ubac2 T G 14: 122,231,674 (GRCm39) V200G probably benign Het
Ubr5 G A 15: 37,981,161 (GRCm39) A2372V possibly damaging Het
Ugcg C T 4: 59,219,517 (GRCm39) P285S probably damaging Het
Vmn1r9 T C 6: 57,048,522 (GRCm39) V199A probably damaging Het
Vmn2r118 T A 17: 55,917,406 (GRCm39) K369* probably null Het
Xpnpep3 G T 15: 81,311,554 (GRCm39) A87S probably benign Het
Zc3h7a C T 16: 10,978,890 (GRCm39) R95H probably damaging Het
Zdhhc11 A G 13: 74,122,771 (GRCm39) N169S probably damaging Het
Zfp62 T A 11: 49,107,215 (GRCm39) D435E probably damaging Het
Zfyve16 T C 13: 92,648,033 (GRCm39) D1007G possibly damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,761,272 (GRCm39) splice site probably benign
IGL00862:Trpm6 APN 19 18,804,892 (GRCm39) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,855,015 (GRCm39) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,803,158 (GRCm39) nonsense probably null
IGL01451:Trpm6 APN 19 18,786,933 (GRCm39) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,773,894 (GRCm39) nonsense probably null
IGL01995:Trpm6 APN 19 18,807,691 (GRCm39) splice site probably benign
IGL02092:Trpm6 APN 19 18,749,695 (GRCm39) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,809,903 (GRCm39) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,831,427 (GRCm39) missense probably benign
IGL02329:Trpm6 APN 19 18,831,581 (GRCm39) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,755,874 (GRCm39) splice site probably benign
IGL02402:Trpm6 APN 19 18,764,120 (GRCm39) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,804,762 (GRCm39) nonsense probably null
IGL02457:Trpm6 APN 19 18,803,155 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,779,571 (GRCm39) splice site probably benign
IGL02705:Trpm6 APN 19 18,754,097 (GRCm39) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,787,016 (GRCm39) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,807,376 (GRCm39) splice site probably benign
IGL02818:Trpm6 APN 19 18,843,621 (GRCm39) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,790,846 (GRCm39) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,815,381 (GRCm39) nonsense probably null
IGL03193:Trpm6 APN 19 18,803,236 (GRCm39) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,764,143 (GRCm39) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,796,483 (GRCm39) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,796,545 (GRCm39) missense probably benign
IGL03245:Trpm6 APN 19 18,855,065 (GRCm39) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,815,446 (GRCm39) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,790,850 (GRCm39) missense probably benign
P0043:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,803,166 (GRCm39) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,764,119 (GRCm39) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,809,957 (GRCm39) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,796,558 (GRCm39) splice site probably null
R0267:Trpm6 UTSW 19 18,800,742 (GRCm39) missense probably benign
R0350:Trpm6 UTSW 19 18,861,321 (GRCm39) splice site probably null
R0373:Trpm6 UTSW 19 18,830,951 (GRCm39) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,756,008 (GRCm39) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,760,389 (GRCm39) splice site probably benign
R0505:Trpm6 UTSW 19 18,851,266 (GRCm39) splice site probably benign
R0526:Trpm6 UTSW 19 18,770,240 (GRCm39) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,849,585 (GRCm39) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,803,226 (GRCm39) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,815,451 (GRCm39) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,773,862 (GRCm39) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,773,859 (GRCm39) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,853,295 (GRCm39) missense probably benign
R1558:Trpm6 UTSW 19 18,764,192 (GRCm39) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,804,888 (GRCm39) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,854,995 (GRCm39) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,833,581 (GRCm39) missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18,804,931 (GRCm39) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,869,363 (GRCm39) splice site probably null
R1991:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,831,629 (GRCm39) missense probably benign
R2073:Trpm6 UTSW 19 18,853,406 (GRCm39) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,855,103 (GRCm39) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,803,116 (GRCm39) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,790,714 (GRCm39) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,769,454 (GRCm39) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,831,795 (GRCm39) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,749,757 (GRCm39) nonsense probably null
R3779:Trpm6 UTSW 19 18,853,403 (GRCm39) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,809,921 (GRCm39) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,804,889 (GRCm39) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,773,864 (GRCm39) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,809,841 (GRCm39) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,809,961 (GRCm39) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,803,236 (GRCm39) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,831,564 (GRCm39) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,853,428 (GRCm39) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,790,857 (GRCm39) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,845,345 (GRCm39) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,839,576 (GRCm39) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,764,124 (GRCm39) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,790,828 (GRCm39) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,807,297 (GRCm39) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,807,571 (GRCm39) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,830,968 (GRCm39) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,830,981 (GRCm39) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,764,183 (GRCm39) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,833,539 (GRCm39) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,869,383 (GRCm39) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6105:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6211:Trpm6 UTSW 19 18,760,492 (GRCm39) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,831,655 (GRCm39) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,831,472 (GRCm39) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,807,354 (GRCm39) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,815,406 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,866,384 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,773,803 (GRCm39) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,807,661 (GRCm39) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,760,527 (GRCm39) missense probably benign
R7103:Trpm6 UTSW 19 18,790,911 (GRCm39) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,831,397 (GRCm39) nonsense probably null
R7128:Trpm6 UTSW 19 18,789,137 (GRCm39) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,854,150 (GRCm39) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,755,949 (GRCm39) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,853,455 (GRCm39) missense probably benign 0.30
R7498:Trpm6 UTSW 19 18,853,484 (GRCm39) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,756,029 (GRCm39) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,809,945 (GRCm39) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,845,325 (GRCm39) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,853,377 (GRCm39) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,831,613 (GRCm39) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,804,772 (GRCm39) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,727,409 (GRCm39) splice site probably null
R7807:Trpm6 UTSW 19 18,807,220 (GRCm39) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,792,605 (GRCm39) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,754,074 (GRCm39) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,831,654 (GRCm39) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,853,474 (GRCm39) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,756,023 (GRCm39) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,792,714 (GRCm39) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,770,226 (GRCm39) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,789,154 (GRCm39) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,851,225 (GRCm39) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,831,332 (GRCm39) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,809,849 (GRCm39) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,869,459 (GRCm39) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,815,366 (GRCm39) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,792,799 (GRCm39) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,810,016 (GRCm39) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,761,264 (GRCm39) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,755,978 (GRCm39) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,764,123 (GRCm39) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,853,394 (GRCm39) nonsense probably null
R9564:Trpm6 UTSW 19 18,851,240 (GRCm39) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,790,846 (GRCm39) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,869,466 (GRCm39) missense probably benign
R9721:Trpm6 UTSW 19 18,807,336 (GRCm39) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,800,766 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AACGGAATATACAGTTTCCAATCAC -3'
(R):5'- AGCAAGGATCAACTAGAGTAGAGTTCC -3'

Sequencing Primer
(F):5'- GAAAATGAAACTTGGTGAAATTTGC -3'
(R):5'- CTAGAGTAGAGTTCCCAAGGATTTC -3'
Posted On 2014-06-23