Mutagenetix > Incidental Mutation

Incidental Mutation 'R1840:Trpm6'

205779

Institutional Source

Beutler Lab

Gene Symbol

Trpm6

Ensembl Gene

ENSMUSG00000024727

Gene Name

transient receptor potential cation channel, subfamily M, member 6

Synonyms

CHAK2

MMRRC Submission

039866-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1840 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18749983-18892510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18866267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1665 (D1665G)

Ref Sequence

ENSEMBL: ENSMUSP00000037443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040489]

AlphaFold

Q8CIR4

Predicted Effect

probably benign
Transcript: ENSMUST00000040489
AA Change: D1665G

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: D1665G

Domain	Start	End	E-Value	Type
Blast:ANK	430	459	4e-8	BLAST
low complexity region	580	604	N/A	INTRINSIC
transmembrane domain	749	766	N/A	INTRINSIC
Pfam:Ion_trans	847	1087	2.8e-13	PFAM
low complexity region	1113	1126	N/A	INTRINSIC
low complexity region	1136	1154	N/A	INTRINSIC
Pfam:TRPM_tetra	1176	1231	7.5e-27	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
low complexity region	1578	1596	N/A	INTRINSIC
Blast:Alpha_kinase	1618	1673	9e-11	BLAST
low complexity region	1682	1695	N/A	INTRINSIC
Alpha_kinase	1761	1978	1e-84	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 95.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029I15Rik	T	C	2: 92,383,209	S36P	probably benign	Het
2510009E07Rik	T	A	16: 21,653,486	M85L	probably benign	Het
Aatk	T	G	11: 120,013,732	D206A	probably damaging	Het
Agap3	A	G	5: 24,500,231	D719G	probably damaging	Het
Agrn	G	A	4: 156,167,415	R1797C	probably damaging	Het
Ascc3	T	A	10: 50,690,161	M734K	probably benign	Het
Asph	T	A	4: 9,601,340	M136L	possibly damaging	Het
Atm	A	T	9: 53,456,530	V2431E	probably damaging	Het
Atp2b1	A	G	10: 99,022,929	H1158R	probably benign	Het
Atxn7l1	A	G	12: 33,371,033		probably null	Het
BC024139	G	T	15: 76,120,642	S611R	probably benign	Het
Becn1	C	T	11: 101,295,566	G105S	probably damaging	Het
Bud13	A	G	9: 46,286,408	E70G	probably damaging	Het
Cacul1	A	T	19: 60,534,250	L282*	probably null	Het
Ccar1	T	A	10: 62,763,510	K614M	probably damaging	Het
Cd96	T	C	16: 46,099,092	T189A	probably benign	Het
Cdh5	C	A	8: 104,126,616	Y189*	probably null	Het
Chka	A	G	19: 3,886,460	N284S	probably benign	Het
Cntn6	A	T	6: 104,774,480	I366F	probably damaging	Het
Csmd3	C	T	15: 47,607,164	G3372E	probably damaging	Het
Cyp4f16	T	C	17: 32,543,006		probably null	Het
Dcaf6	A	G	1: 165,399,748	V270A	probably damaging	Het
Ddx60	T	A	8: 61,969,553	I608N	probably damaging	Het
Dnah9	A	T	11: 65,834,198	C1849*	probably null	Het
Eci3	C	A	13: 34,960,041	V34L	probably benign	Het
Epha1	C	T	6: 42,363,588	R583H	probably damaging	Het
Erbin	A	T	13: 103,834,947	N720K	probably benign	Het
Eya1	T	A	1: 14,229,504	R346*	probably null	Het
Fam189a1	C	A	7: 64,759,195	V484L	probably benign	Het
Fhdc1	G	A	3: 84,445,821	T699I	possibly damaging	Het
Flvcr2	T	C	12: 85,803,221	V427A	possibly damaging	Het
Fzd9	T	A	5: 135,249,571	T487S	probably benign	Het
Gas2l3	T	C	10: 89,422,251	Y160C	possibly damaging	Het
Gm10264	T	C	12: 88,329,411	V53A	probably benign	Het
Gm10269	T	C	18: 20,682,809	K52R	probably damaging	Het
Gm16432	A	G	1: 178,003,015	D30G	possibly damaging	Het
Gm8674	A	T	13: 49,901,765		noncoding transcript	Het
Gpr61	A	G	3: 108,150,481	V288A	possibly damaging	Het
Gramd4	T	C	15: 86,130,192		probably null	Het
Gtpbp4	A	G	13: 8,979,464	L403P	probably benign	Het
H6pd	A	T	4: 149,982,050	D626E	possibly damaging	Het
Herc6	T	A	6: 57,658,106	L769*	probably null	Het
Hes5	A	G	4: 154,961,254	K58R	probably damaging	Het
Heyl	A	G	4: 123,241,390	I59V	probably damaging	Het
Hpca	A	G	4: 129,118,600	F48L	probably damaging	Het
Ice1	C	T	13: 70,606,218	R583Q	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kansl1l	T	A	1: 66,778,032	I390F	probably damaging	Het
Kat5	C	T	19: 5,609,238	V95M	possibly damaging	Het
Kcnh4	T	A	11: 100,745,341	I827F	possibly damaging	Het
Kif1b	C	T	4: 149,188,132	R138Q	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lats1	T	A	10: 7,710,939	L955*	probably null	Het
Ldlrad2	A	C	4: 137,572,184	C110G	possibly damaging	Het
Lgi3	G	A	14: 70,534,776		probably null	Het
Lingo1	A	G	9: 56,620,558	M249T	probably benign	Het
Lrig3	A	T	10: 126,013,389	R993*	probably null	Het
Lsm14b	T	A	2: 180,026,728	I74N	probably damaging	Het
Lyplal1	T	A	1: 186,100,217	I114F	probably damaging	Het
Mmp15	A	G	8: 95,365,420	Y86C	probably damaging	Het
Myh2	A	G	11: 67,186,487	E816G	probably benign	Het
Myo5c	A	G	9: 75,249,735	N151S	probably damaging	Het
Nckap1	T	A	2: 80,502,250	E1082V	possibly damaging	Het
Nrg4	A	C	9: 55,282,606		probably benign	Het
Nrp2	T	C	1: 62,738,339	L101P	probably damaging	Het
Olfr1180	T	C	2: 88,412,067	D197G	probably benign	Het
Olfr126	A	T	17: 37,850,748	D52V	probably damaging	Het
Olfr521	A	T	7: 99,767,596	T145S	probably benign	Het
Olfr638	A	G	7: 104,004,117	I281V	probably benign	Het
Olfr992	G	A	2: 85,400,168	R122C	probably benign	Het
Parp14	T	A	16: 35,863,449	E169V	probably damaging	Het
Pcolce2	G	A	9: 95,670,117	R101H	probably damaging	Het
Pcolce2	A	T	9: 95,670,203	N130Y	probably benign	Het
Plscr1	A	T	9: 92,258,074	S5C	unknown	Het
Plxdc2	T	C	2: 16,669,856	V338A	probably benign	Het
Psg23	T	A	7: 18,610,438	N364I	possibly damaging	Het
Psmg4	A	G	13: 34,178,056	E109G	probably damaging	Het
Ptk2	T	C	15: 73,210,884	E908G	probably damaging	Het
Ptpn14	G	A	1: 189,786,851	R26H	probably damaging	Het
Ranbp2	T	A	10: 58,478,766	N1769K	probably benign	Het
Rbm14	C	T	19: 4,801,795		probably benign	Het
Rgs7	A	T	1: 175,153,148	D103E	probably damaging	Het
Rmnd5a	G	A	6: 71,398,455	L80F	probably benign	Het
Rock2	T	A	12: 16,928,989	D93E	probably benign	Het
Rps6ka6	A	G	X: 111,420,932	I246T	possibly damaging	Het
Rubcn	T	C	16: 32,826,172	M803V	possibly damaging	Het
Ryr3	T	C	2: 112,750,820	Y2889C	probably damaging	Het
Sall2	T	C	14: 52,313,725	N671S	probably damaging	Het
Selplg	T	C	5: 113,819,844	T134A	possibly damaging	Het
Sez6	C	A	11: 77,953,717	T122N	possibly damaging	Het
Slc9b1	T	A	3: 135,357,468	D4E	unknown	Het
Smim18	A	G	8: 33,742,348	M81T	probably benign	Het
Snap91	A	T	9: 86,815,465	H281Q	probably damaging	Het
Sparc	C	A	11: 55,395,866	C302F	probably damaging	Het
Spg11	A	G	2: 122,101,756	L535P	probably damaging	Het
Spsb1	G	A	4: 149,906,631	T160I	probably damaging	Het
Stra6	A	G	9: 58,140,530	N128S	probably benign	Het
Strc	T	C	2: 121,379,296	E182G	probably damaging	Het
Sult2a6	A	G	7: 14,254,829	M2T	probably benign	Het
Sv2c	T	C	13: 95,981,844	N499S	probably benign	Het
Szt2	A	T	4: 118,365,657		probably benign	Het
Tbx20	A	T	9: 24,725,676	S372T	probably benign	Het
Tcp11l2	T	A	10: 84,604,599	S289T	probably damaging	Het
Tdrd1	A	G	19: 56,842,312	E259G	probably damaging	Het
Thsd7a	T	A	6: 12,330,974	I1390L	probably benign	Het
Tln2	G	A	9: 67,342,043	R921W	probably damaging	Het
Tmem126a	C	A	7: 90,452,884	G36*	probably null	Het
Tmem245	C	T	4: 56,903,947	V606I	probably benign	Het
Ubac2	T	G	14: 121,994,262	V200G	probably benign	Het
Ubr5	G	A	15: 37,980,917	A2372V	possibly damaging	Het
Ugcg	C	T	4: 59,219,517	P285S	probably damaging	Het
Vmn1r9	T	C	6: 57,071,537	V199A	probably damaging	Het
Vmn2r118	T	A	17: 55,610,406	K369*	probably null	Het
Xpnpep3	G	T	15: 81,427,353	A87S	probably benign	Het
Zc3h7a	C	T	16: 11,161,026	R95H	probably damaging	Het
Zdhhc11	A	G	13: 73,974,652	N169S	probably damaging	Het
Zfp62	T	A	11: 49,216,388	D435E	probably damaging	Het
Zfyve16	T	C	13: 92,511,525	D1007G	possibly damaging	Het

Other mutations in Trpm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Trpm6	APN	19	18783908	splice site	probably benign
IGL00862:Trpm6	APN	19	18827528	missense	probably damaging	1.00
IGL01348:Trpm6	APN	19	18877651	missense	probably damaging	1.00
IGL01400:Trpm6	APN	19	18825794	nonsense	probably null
IGL01451:Trpm6	APN	19	18809569	missense	probably damaging	1.00
IGL01508:Trpm6	APN	19	18796530	nonsense	probably null
IGL01995:Trpm6	APN	19	18830327	splice site	probably benign
IGL02092:Trpm6	APN	19	18772331	missense	possibly damaging	0.59
IGL02152:Trpm6	APN	19	18832539	missense	possibly damaging	0.93
IGL02294:Trpm6	APN	19	18854063	missense	probably benign
IGL02329:Trpm6	APN	19	18854217	missense	probably benign	0.17
IGL02366:Trpm6	APN	19	18778510	splice site	probably benign
IGL02402:Trpm6	APN	19	18786756	missense	probably benign	0.18
IGL02457:Trpm6	APN	19	18825791	missense	probably damaging	1.00
IGL02457:Trpm6	APN	19	18827398	nonsense	probably null
IGL02684:Trpm6	APN	19	18802207	splice site	probably benign
IGL02705:Trpm6	APN	19	18776733	critical splice donor site	probably null
IGL02728:Trpm6	APN	19	18809652	missense	possibly damaging	0.71
IGL02742:Trpm6	APN	19	18830012	splice site	probably benign
IGL02818:Trpm6	APN	19	18866257	missense	probably benign	0.04
IGL02836:Trpm6	APN	19	18813482	missense	probably damaging	1.00
IGL03119:Trpm6	APN	19	18838017	nonsense	probably null
IGL03193:Trpm6	APN	19	18825872	missense	possibly damaging	0.94
IGL03227:Trpm6	APN	19	18819119	missense	probably benign	0.01
IGL03227:Trpm6	APN	19	18786779	missense	probably benign	0.12
IGL03231:Trpm6	APN	19	18819181	missense	probably benign
IGL03245:Trpm6	APN	19	18877701	missense	probably damaging	1.00
IGL03328:Trpm6	APN	19	18838082	missense	possibly damaging	0.94
IGL03341:Trpm6	APN	19	18813486	missense	probably benign
P0043:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
PIT4260001:Trpm6	UTSW	19	18825802	missense	possibly damaging	0.48
R0057:Trpm6	UTSW	19	18786755	missense	probably benign	0.05
R0115:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R0119:Trpm6	UTSW	19	18832593	missense	probably benign	0.05
R0140:Trpm6	UTSW	19	18819194	splice site	probably null
R0267:Trpm6	UTSW	19	18823378	missense	probably benign
R0350:Trpm6	UTSW	19	18883957	splice site	probably null
R0373:Trpm6	UTSW	19	18853587	missense	probably benign	0.15
R0393:Trpm6	UTSW	19	18778644	missense	probably damaging	0.99
R0416:Trpm6	UTSW	19	18783025	splice site	probably benign
R0505:Trpm6	UTSW	19	18873902	splice site	probably benign
R0526:Trpm6	UTSW	19	18792876	missense	probably damaging	0.97
R0607:Trpm6	UTSW	19	18872221	missense	probably benign	0.00
R0609:Trpm6	UTSW	19	18825862	missense	probably damaging	0.97
R0714:Trpm6	UTSW	19	18838087	missense	possibly damaging	0.90
R1215:Trpm6	UTSW	19	18796498	missense	probably damaging	1.00
R1474:Trpm6	UTSW	19	18796495	missense	probably benign	0.28
R1512:Trpm6	UTSW	19	18875931	missense	probably benign
R1558:Trpm6	UTSW	19	18786828	missense	probably benign	0.04
R1597:Trpm6	UTSW	19	18827524	missense	probably damaging	0.98
R1618:Trpm6	UTSW	19	18877631	missense	possibly damaging	0.88
R1779:Trpm6	UTSW	19	18856217	missense	probably damaging	1.00
R1796:Trpm6	UTSW	19	18827567	missense	possibly damaging	0.90
R1799:Trpm6	UTSW	19	18891999	splice site	probably null
R1991:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2030:Trpm6	UTSW	19	18854265	missense	probably benign
R2073:Trpm6	UTSW	19	18876042	missense	probably damaging	1.00
R2074:Trpm6	UTSW	19	18877739	missense	probably damaging	1.00
R2096:Trpm6	UTSW	19	18825752	missense	probably damaging	0.97
R2103:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2106:Trpm6	UTSW	19	18813350	missense	possibly damaging	0.95
R2117:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R2850:Trpm6	UTSW	19	18792090	missense	possibly damaging	0.68
R3125:Trpm6	UTSW	19	18854431	missense	probably benign	0.05
R3719:Trpm6	UTSW	19	18772393	nonsense	probably null
R3779:Trpm6	UTSW	19	18876039	missense	possibly damaging	0.80
R4115:Trpm6	UTSW	19	18832557	missense	probably damaging	1.00
R4367:Trpm6	UTSW	19	18827525	missense	probably damaging	0.99
R4523:Trpm6	UTSW	19	18796500	missense	probably damaging	1.00
R4546:Trpm6	UTSW	19	18832477	missense	probably damaging	1.00
R4564:Trpm6	UTSW	19	18832597	missense	possibly damaging	0.95
R4565:Trpm6	UTSW	19	18825872	missense	probably damaging	1.00
R4697:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R4714:Trpm6	UTSW	19	18854200	missense	possibly damaging	0.93
R4750:Trpm6	UTSW	19	18876064	missense	probably damaging	0.99
R4771:Trpm6	UTSW	19	18813493	missense	probably damaging	0.97
R4791:Trpm6	UTSW	19	18867981	missense	probably benign	0.00
R4814:Trpm6	UTSW	19	18862212	missense	probably benign	0.11
R5028:Trpm6	UTSW	19	18786760	missense	probably damaging	1.00
R5237:Trpm6	UTSW	19	18813464	missense	probably damaging	1.00
R5615:Trpm6	UTSW	19	18829933	missense	probably damaging	0.96
R5642:Trpm6	UTSW	19	18830207	missense	probably damaging	1.00
R5645:Trpm6	UTSW	19	18853604	missense	probably damaging	1.00
R5726:Trpm6	UTSW	19	18853617	missense	probably damaging	1.00
R5832:Trpm6	UTSW	19	18786819	missense	possibly damaging	0.66
R5843:Trpm6	UTSW	19	18856175	missense	probably benign	0.04
R5955:Trpm6	UTSW	19	18892019	missense	possibly damaging	0.75
R6101:Trpm6	UTSW	19	18853748	nonsense	probably null
R6105:Trpm6	UTSW	19	18853748	nonsense	probably null
R6211:Trpm6	UTSW	19	18783128	missense	probably damaging	1.00
R6228:Trpm6	UTSW	19	18854291	missense	probably damaging	1.00
R6263:Trpm6	UTSW	19	18854108	missense	possibly damaging	0.94
R6453:Trpm6	UTSW	19	18829990	missense	probably damaging	1.00
R6562:Trpm6	UTSW	19	18838042	missense	probably damaging	1.00
R6624:Trpm6	UTSW	19	18796439	critical splice acceptor site	probably null
R6624:Trpm6	UTSW	19	18889020	missense	probably damaging	1.00
R6729:Trpm6	UTSW	19	18830297	missense	probably damaging	1.00
R6765:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
R6976:Trpm6	UTSW	19	18783163	missense	probably benign
R7103:Trpm6	UTSW	19	18813547	missense	possibly damaging	0.87
R7126:Trpm6	UTSW	19	18854033	nonsense	probably null
R7128:Trpm6	UTSW	19	18811773	missense	possibly damaging	0.92
R7157:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R7212:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R7263:Trpm6	UTSW	19	18876786	missense	probably damaging	1.00
R7268:Trpm6	UTSW	19	18778585	missense	probably benign	0.13
R7305:Trpm6	UTSW	19	18876091	missense	probably benign	0.30
R7498:Trpm6	UTSW	19	18876120	missense	probably damaging	1.00
R7558:Trpm6	UTSW	19	18778665	missense	probably damaging	0.96
R7590:Trpm6	UTSW	19	18832581	missense	probably benign	0.31
R7646:Trpm6	UTSW	19	18867961	missense	probably benign	0.10
R7650:Trpm6	UTSW	19	18876013	missense	possibly damaging	0.70
R7727:Trpm6	UTSW	19	18854249	missense	probably damaging	0.97
R7743:Trpm6	UTSW	19	18827408	missense	probably benign	0.03
R7747:Trpm6	UTSW	19	18750045	splice site	probably null
R7807:Trpm6	UTSW	19	18829856	missense	probably benign	0.11
R7870:Trpm6	UTSW	19	18815241	missense	probably benign	0.01
R7891:Trpm6	UTSW	19	18776710	missense	probably benign	0.01
R7955:Trpm6	UTSW	19	18854290	missense	probably benign	0.01
R7965:Trpm6	UTSW	19	18876110	missense	probably damaging	1.00
R7967:Trpm6	UTSW	19	18778659	missense	probably damaging	0.99
R7992:Trpm6	UTSW	19	18815350	missense	probably damaging	1.00
R8035:Trpm6	UTSW	19	18792862	missense	probably damaging	0.97
R8108:Trpm6	UTSW	19	18811790	missense	probably damaging	1.00
R8268:Trpm6	UTSW	19	18873861	missense	possibly damaging	0.85
R8411:Trpm6	UTSW	19	18853968	missense	probably benign	0.39
R8413:Trpm6	UTSW	19	18832485	missense	probably benign	0.00
R8534:Trpm6	UTSW	19	18892095	missense	probably benign	0.00
R8932:Trpm6	UTSW	19	18838002	missense	possibly damaging	0.87
R8990:Trpm6	UTSW	19	18815435	missense	probably damaging	1.00
R9403:Trpm6	UTSW	19	18832652	missense	possibly damaging	0.84
R9446:Trpm6	UTSW	19	18838098	missense	possibly damaging	0.91
R9463:Trpm6	UTSW	19	18783900	critical splice donor site	probably null
R9485:Trpm6	UTSW	19	18778614	missense	probably benign	0.06
R9536:Trpm6	UTSW	19	18786759	missense	probably damaging	1.00
R9549:Trpm6	UTSW	19	18876030	nonsense	probably null
R9564:Trpm6	UTSW	19	18873876	missense	possibly damaging	0.92
R9626:Trpm6	UTSW	19	18813482	missense	probably damaging	1.00
R9655:Trpm6	UTSW	19	18892102	missense	probably benign
R9721:Trpm6	UTSW	19	18829972	missense	probably benign	0.12
R9742:Trpm6	UTSW	19	18823402	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AACGGAATATACAGTTTCCAATCAC -3'
(R):5'- AGCAAGGATCAACTAGAGTAGAGTTCC -3'

Sequencing Primer
(F):5'- GAAAATGAAACTTGGTGAAATTTGC -3'
(R):5'- CTAGAGTAGAGTTCCCAAGGATTTC -3'

Posted On

2014-06-23