Incidental Mutation 'R1842:Kansl3'
ID205786
Institutional Source Beutler Lab
Gene Symbol Kansl3
Ensembl Gene ENSMUSG00000010453
Gene NameKAT8 regulatory NSL complex subunit 3
Synonyms
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1842 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location36335730-36369181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36351744 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 304 (V304A)
Ref Sequence ENSEMBL: ENSMUSP00000140547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010597] [ENSMUST00000185912] [ENSMUST00000186470] [ENSMUST00000188528] [ENSMUST00000188961]
Predicted Effect probably damaging
Transcript: ENSMUST00000010597
AA Change: V403A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010597
Gene: ENSMUSG00000010453
AA Change: V403A

DomainStartEndE-ValueType
low complexity region 113 125 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:Abhydrolase_5 288 436 2e-9 PFAM
low complexity region 523 555 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 718 732 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184898
Predicted Effect probably damaging
Transcript: ENSMUST00000185912
AA Change: V304A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140547
Gene: ENSMUSG00000010453
AA Change: V304A

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 172 186 N/A INTRINSIC
Pfam:Abhydrolase_5 189 337 9.3e-8 PFAM
low complexity region 424 456 N/A INTRINSIC
low complexity region 570 598 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186470
AA Change: V403A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140597
Gene: ENSMUSG00000010453
AA Change: V403A

DomainStartEndE-ValueType
low complexity region 113 125 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
Pfam:Abhydrolase_5 288 436 2.2e-9 PFAM
low complexity region 523 555 N/A INTRINSIC
low complexity region 578 586 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
low complexity region 744 758 N/A INTRINSIC
low complexity region 761 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188528
Predicted Effect probably benign
Transcript: ENSMUST00000188961
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dcdc2a T C 13: 25,107,602 L190S probably damaging Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Efcab5 A G 11: 77,134,875 V538A probably benign Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Gad1 G T 2: 70,574,253 E162D probably benign Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Hspa5 A G 2: 34,775,803 D553G probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kdm5d C T Y: 927,798 S716L probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Map4k1 T C 7: 28,987,163 L170P probably damaging Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Pacs1 T C 19: 5,155,884 E288G probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slc18b1 T C 10: 23,805,993 S152P possibly damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Timm44 A G 8: 4,260,510 probably null Het
Tomm40 A G 7: 19,713,725 S127P probably benign Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Kansl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Kansl3 APN 1 36367989 start gained probably benign
IGL02277:Kansl3 APN 1 36348947 missense possibly damaging 0.85
IGL02423:Kansl3 APN 1 36351969 missense probably damaging 1.00
R0147:Kansl3 UTSW 1 36353816 missense probably damaging 1.00
R0148:Kansl3 UTSW 1 36353816 missense probably damaging 1.00
R0255:Kansl3 UTSW 1 36344969 missense probably benign 0.01
R0279:Kansl3 UTSW 1 36351969 missense probably damaging 0.99
R0349:Kansl3 UTSW 1 36351783 missense probably damaging 1.00
R1452:Kansl3 UTSW 1 36354793 splice site probably benign
R1599:Kansl3 UTSW 1 36367870 missense probably damaging 1.00
R2310:Kansl3 UTSW 1 36343364 missense probably damaging 1.00
R4093:Kansl3 UTSW 1 36344954 missense probably damaging 1.00
R4961:Kansl3 UTSW 1 36348683 critical splice acceptor site probably null
R5339:Kansl3 UTSW 1 36367721 intron probably benign
R5400:Kansl3 UTSW 1 36358149 missense possibly damaging 0.93
R5564:Kansl3 UTSW 1 36345964 missense possibly damaging 0.55
R5661:Kansl3 UTSW 1 36348957 missense possibly damaging 0.55
R5965:Kansl3 UTSW 1 36345520 intron probably null
R6185:Kansl3 UTSW 1 36346018 missense probably damaging 0.96
R6261:Kansl3 UTSW 1 36365605 missense probably benign 0.01
R6706:Kansl3 UTSW 1 36344914 critical splice donor site probably null
R7055:Kansl3 UTSW 1 36365620 missense possibly damaging 0.86
R7134:Kansl3 UTSW 1 36351767 missense possibly damaging 0.52
R7362:Kansl3 UTSW 1 36344127 missense possibly damaging 0.82
R7461:Kansl3 UTSW 1 36343795 missense probably damaging 1.00
R7571:Kansl3 UTSW 1 36365587 missense possibly damaging 0.55
R7613:Kansl3 UTSW 1 36343795 missense probably damaging 1.00
R7775:Kansl3 UTSW 1 36348677 missense probably damaging 0.99
R7778:Kansl3 UTSW 1 36348677 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTTTATTCGGCCACGG -3'
(R):5'- CCTCTGCTTACTGTGGATGGAC -3'

Sequencing Primer
(F):5'- TATTCGGCCACGGATAAACATTCTC -3'
(R):5'- CTTACTGTGGATGGACCCAGG -3'
Posted On2014-06-23