Incidental Mutation 'R1842:Adcy10'
ID 205793
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 039867-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R1842 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 165330812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 25 (V25D)
Ref Sequence ENSEMBL: ENSMUSP00000137744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: V25D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: V25D

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: V25D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: V25D

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: V25D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: V25D

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000148550
AA Change: V25D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: V25D

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155216
AA Change: V25D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567
AA Change: V25D

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157261
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G T 11: 110,087,865 (GRCm39) N1087K probably benign Het
Abcc3 G A 11: 94,250,438 (GRCm39) T921I probably benign Het
Abr T A 11: 76,399,812 (GRCm39) I4F probably damaging Het
Ahnak T A 19: 8,983,231 (GRCm39) M1505K probably damaging Het
Alms1-ps2 T C 6: 85,773,231 (GRCm39) noncoding transcript Het
Apob C G 12: 8,061,559 (GRCm39) T3347S probably damaging Het
Arhgap27 C A 11: 103,230,822 (GRCm39) G11W probably damaging Het
Ccdc110 A T 8: 46,393,605 (GRCm39) I106F probably damaging Het
Ccdc28b T A 4: 129,514,806 (GRCm39) D101V probably damaging Het
Ccdc30 T C 4: 119,188,324 (GRCm39) E566G probably benign Het
Cenpm T C 15: 82,123,565 (GRCm39) S111G probably benign Het
Cep55 A G 19: 38,046,348 (GRCm39) I34V probably benign Het
Dcdc2a T C 13: 25,291,585 (GRCm39) L190S probably damaging Het
Dhh T C 15: 98,792,441 (GRCm39) probably null Het
Dst A G 1: 34,203,200 (GRCm39) N703S probably null Het
E030025P04Rik G A 11: 109,030,396 (GRCm39) L164F unknown Het
Efcab5 A G 11: 77,025,701 (GRCm39) V538A probably benign Het
Egflam A G 15: 7,333,422 (GRCm39) S177P probably benign Het
Ehbp1l1 A T 19: 5,775,958 (GRCm39) C31S probably damaging Het
Eif2d C A 1: 131,098,797 (GRCm39) Q532K probably damaging Het
Elf3 T C 1: 135,184,531 (GRCm39) D175G possibly damaging Het
F5 T C 1: 164,012,129 (GRCm39) V449A probably damaging Het
Fam110a A T 2: 151,811,954 (GRCm39) I272N probably damaging Het
Fbxo34 A G 14: 47,768,464 (GRCm39) D608G probably damaging Het
Flrt2 T C 12: 95,746,058 (GRCm39) L132P probably damaging Het
Frg2f1 A T 4: 119,388,277 (GRCm39) V74D possibly damaging Het
Gad1 G T 2: 70,404,597 (GRCm39) E162D probably benign Het
Glb1l A G 1: 75,177,104 (GRCm39) V444A probably damaging Het
Gm10770 G A 2: 150,021,076 (GRCm39) T147I probably damaging Het
Gm43302 T C 5: 105,425,602 (GRCm39) I276V probably benign Het
Greb1 T C 12: 16,746,244 (GRCm39) H1314R probably damaging Het
Hapln2 A G 3: 87,931,308 (GRCm39) V69A probably damaging Het
Hcn1 T C 13: 118,112,544 (GRCm39) I836T probably damaging Het
Hspa5 A G 2: 34,665,815 (GRCm39) D553G probably damaging Het
Iqgap1 A T 7: 80,410,631 (GRCm39) I194N probably damaging Het
Kansl3 A G 1: 36,390,825 (GRCm39) V304A probably damaging Het
Kdm5d C T Y: 927,798 (GRCm39) S716L probably damaging Het
Klra6 T C 6: 129,999,573 (GRCm39) T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrp1 A G 10: 127,409,337 (GRCm39) I1594T possibly damaging Het
Lrp2bp A G 8: 46,464,152 (GRCm39) D15G probably benign Het
Map4k1 T C 7: 28,686,588 (GRCm39) L170P probably damaging Het
Mast3 A G 8: 71,233,037 (GRCm39) F1108L possibly damaging Het
Mettl5 G T 2: 69,715,686 (GRCm39) L6I unknown Het
Mfsd14a A T 3: 116,426,057 (GRCm39) F447I possibly damaging Het
Mrc2 A G 11: 105,228,546 (GRCm39) I642V probably damaging Het
Necap1 A G 6: 122,851,547 (GRCm39) Y7C probably damaging Het
Nsd1 G A 13: 55,394,258 (GRCm39) E723K probably damaging Het
Nsun3 A T 16: 62,596,755 (GRCm39) L121H probably damaging Het
Nsun6 A T 2: 15,014,288 (GRCm39) M284K probably damaging Het
Nutf2 T C 8: 106,603,242 (GRCm39) probably null Het
Odad2 A T 18: 7,223,551 (GRCm39) D497E probably benign Het
Or1j20 A T 2: 36,759,601 (GRCm39) N8Y probably damaging Het
Or5d38 A T 2: 87,954,471 (GRCm39) M286K probably damaging Het
Pacs1 T C 19: 5,205,912 (GRCm39) E288G probably damaging Het
Peg10 A T 6: 4,756,381 (GRCm39) probably benign Het
Rab38 G A 7: 88,099,730 (GRCm39) E82K possibly damaging Het
Rgsl1 T A 1: 153,675,543 (GRCm39) E206V probably damaging Het
Saxo5 T A 8: 3,533,668 (GRCm39) F295L possibly damaging Het
Scube3 G A 17: 28,384,063 (GRCm39) V521I probably damaging Het
Sgpp1 C T 12: 75,762,982 (GRCm39) V400M probably damaging Het
Slc18b1 T C 10: 23,681,891 (GRCm39) S152P possibly damaging Het
Slit1 A T 19: 41,709,477 (GRCm39) probably null Het
Spata31d1e T C 13: 59,890,320 (GRCm39) Y82C probably damaging Het
Spta1 A G 1: 174,023,513 (GRCm39) K640R probably benign Het
Svil A G 18: 5,062,373 (GRCm39) T898A probably damaging Het
Timm44 A G 8: 4,310,510 (GRCm39) probably null Het
Tomm40 A G 7: 19,447,650 (GRCm39) S127P probably benign Het
Vmn2r23 T A 6: 123,706,649 (GRCm39) V493D possibly damaging Het
Yeats2 T C 16: 19,989,988 (GRCm39) V288A probably damaging Het
Zfhx4 C T 3: 5,466,558 (GRCm39) R2239W probably damaging Het
Zscan2 A C 7: 80,525,301 (GRCm39) K341Q probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,337,959 (GRCm39) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,347,088 (GRCm39) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,340,699 (GRCm39) missense probably benign
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,345,781 (GRCm39) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,331,618 (GRCm39) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,391,532 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,384,485 (GRCm39) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,337,939 (GRCm39) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,378,867 (GRCm39) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AACAAATGCATCCGTTAGATTCCC -3'
(R):5'- GTGCACAGTGAGATGAGCTG -3'

Sequencing Primer
(F):5'- ATGCATCCGTTAGATTCCCTCCATTC -3'
(R):5'- CACAGTGAGATGAGCTGTTCTG -3'
Posted On 2014-06-23