Incidental Mutation 'R1842:Hspa5'
ID205796
Institutional Source Beutler Lab
Gene Symbol Hspa5
Ensembl Gene ENSMUSG00000026864
Gene Nameheat shock protein 5
SynonymsBip, 78kDa, Sez7, Grp78, D2Wsu141e, D2Wsu17e, Hsce70, XAP-1 antigen, mBiP, baffled
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1842 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34771970-34777547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34775803 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 553 (D553G)
Ref Sequence ENSEMBL: ENSMUSP00000097747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028222] [ENSMUST00000100171] [ENSMUST00000113086] [ENSMUST00000118108] [ENSMUST00000137145] [ENSMUST00000145903]
Predicted Effect probably damaging
Transcript: ENSMUST00000028222
AA Change: D553G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028222
Gene: ENSMUSG00000026864
AA Change: D553G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:HSP70 31 637 8.2e-276 PFAM
Pfam:MreB_Mbl 136 406 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047963
SMART Domains Protein: ENSMUSP00000037746
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 5 51 6.7e-13 PFAM
Pfam:Kelch_4 5 58 2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100171
AA Change: D553G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097747
Gene: ENSMUSG00000026864
AA Change: D553G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:HSP70 31 637 3.3e-278 PFAM
Pfam:MreB_Mbl 136 406 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113086
SMART Domains Protein: ENSMUSP00000108709
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 30 82 5e-15 PFAM
Pfam:Kelch_4 30 86 6.7e-10 PFAM
Pfam:Kelch_3 47 96 1e-12 PFAM
Pfam:Kelch_4 87 140 4.6e-7 PFAM
Pfam:Kelch_3 98 150 1.6e-9 PFAM
Pfam:Kelch_5 138 174 6.2e-8 PFAM
Pfam:Kelch_1 141 186 8.3e-7 PFAM
Pfam:Kelch_4 141 190 2.3e-10 PFAM
Pfam:Kelch_6 141 190 4.1e-10 PFAM
Pfam:Kelch_3 151 200 3.5e-8 PFAM
Pfam:Kelch_5 188 225 1.8e-7 PFAM
Pfam:Kelch_1 191 233 2.8e-9 PFAM
Pfam:Kelch_4 193 240 9.4e-9 PFAM
Pfam:Kelch_3 201 250 6.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118108
SMART Domains Protein: ENSMUSP00000113099
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 30 82 2.8e-16 PFAM
Pfam:Kelch_4 30 82 3.7e-6 PFAM
Pfam:Kelch_3 99 147 8.2e-9 PFAM
Pfam:Kelch_4 138 191 2.7e-6 PFAM
Pfam:Kelch_3 149 201 7.9e-9 PFAM
Pfam:Kelch_5 189 225 2.8e-7 PFAM
Pfam:Kelch_1 192 237 5.2e-6 PFAM
Pfam:Kelch_4 192 241 1.3e-9 PFAM
Pfam:Kelch_6 192 241 2.4e-9 PFAM
Pfam:Kelch_3 202 251 1.7e-7 PFAM
Pfam:Kelch_5 239 276 8.1e-7 PFAM
Pfam:Kelch_1 242 284 1.8e-8 PFAM
Pfam:Kelch_4 244 291 5.5e-8 PFAM
Pfam:Kelch_3 252 301 3.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129333
Predicted Effect probably benign
Transcript: ENSMUST00000137145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145466
Predicted Effect probably benign
Transcript: ENSMUST00000145903
SMART Domains Protein: ENSMUSP00000122360
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 38 90 1.5e-17 PFAM
Pfam:Kelch_4 38 90 2.2e-7 PFAM
Pfam:Kelch_1 55 87 4.5e-7 PFAM
Pfam:Kelch_3 107 155 7e-10 PFAM
Pfam:Kelch_4 146 199 4e-7 PFAM
Pfam:Kelch_3 157 209 1.5e-10 PFAM
Pfam:Kelch_5 197 231 1e-8 PFAM
Pfam:Kelch_4 200 249 3.4e-9 PFAM
Pfam:Kelch_5 247 284 5.1e-8 PFAM
Pfam:Kelch_1 250 292 2.9e-9 PFAM
Pfam:Kelch_6 250 301 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155595
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010]
PHENOTYPE: Nullizygous embryos die around implantation. Neonates homozygous for a knock-in allele die of respiratory failure. Mice homozygous for an ENU-induced mutation exhibit abnormal thalamocortical axon patterning, small kidneys, cleft palate, respiratory distress, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dcdc2a T C 13: 25,107,602 L190S probably damaging Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Efcab5 A G 11: 77,134,875 V538A probably benign Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Gad1 G T 2: 70,574,253 E162D probably benign Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kansl3 A G 1: 36,351,744 V304A probably damaging Het
Kdm5d C T Y: 927,798 S716L probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Map4k1 T C 7: 28,987,163 L170P probably damaging Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Pacs1 T C 19: 5,155,884 E288G probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slc18b1 T C 10: 23,805,993 S152P possibly damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Timm44 A G 8: 4,260,510 probably null Het
Tomm40 A G 7: 19,713,725 S127P probably benign Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Hspa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Hspa5 APN 2 34774718 missense probably benign
IGL01997:Hspa5 APN 2 34772315 utr 5 prime probably benign
IGL02239:Hspa5 APN 2 34772776 missense probably benign 0.00
IGL03326:Hspa5 APN 2 34776117 unclassified probably benign
R0281:Hspa5 UTSW 2 34774320 missense probably damaging 1.00
R1052:Hspa5 UTSW 2 34775098 missense probably damaging 0.99
R1687:Hspa5 UTSW 2 34775824 missense probably benign 0.00
R1741:Hspa5 UTSW 2 34772692 missense possibly damaging 0.91
R1833:Hspa5 UTSW 2 34776053 nonsense probably null
R1851:Hspa5 UTSW 2 34774678 missense possibly damaging 0.64
R1864:Hspa5 UTSW 2 34774541 missense probably damaging 0.99
R1865:Hspa5 UTSW 2 34774541 missense probably damaging 0.99
R2173:Hspa5 UTSW 2 34774662 missense probably damaging 1.00
R5027:Hspa5 UTSW 2 34775815 missense probably damaging 1.00
R5889:Hspa5 UTSW 2 34774617 missense probably damaging 1.00
R6046:Hspa5 UTSW 2 34775749 missense possibly damaging 0.94
R6515:Hspa5 UTSW 2 34772404 missense probably benign 0.05
R7045:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7046:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7047:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7049:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7185:Hspa5 UTSW 2 34775126 missense probably damaging 1.00
R7238:Hspa5 UTSW 2 34772371 missense unknown
X0067:Hspa5 UTSW 2 34775101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGATCTGACTGGAATTCCTCC -3'
(R):5'- TTCAATGTCCGCATCCTGGTG -3'

Sequencing Primer
(F):5'- CGTGGAGTTCCCCAGATTGAAG -3'
(R):5'- CGCATCCTGGTGGCTTTC -3'
Posted On2014-06-23